Incidental Mutation 'R4201:Bag3'
ID318752
Institutional Source Beutler Lab
Gene Symbol Bag3
Ensembl Gene ENSMUSG00000030847
Gene NameBCL2-associated athanogene 3
SynonymsBcl-2-interacting death suppressor, Bis
MMRRC Submission 041031-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4201 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128523616-128546981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 128546157 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 499 (L499I)
Ref Sequence ENSEMBL: ENSMUSP00000033136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033136]
PDB Structure
Solution structure of the Murine BAG domain of Bcl2-associated athanogene 3 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000033136
AA Change: L499I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033136
Gene: ENSMUSG00000030847
AA Change: L499I

DomainStartEndE-ValueType
WW 23 56 1.49e-11 SMART
internal_repeat_1 90 151 3.37e-5 PROSPERO
low complexity region 158 171 N/A INTRINSIC
low complexity region 176 204 N/A INTRINSIC
internal_repeat_1 206 283 3.37e-5 PROSPERO
low complexity region 372 392 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
BAG 426 503 9.22e-27 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The protein encoded by this gene contains a WW domain in the N-terminal region and a BAG domain in the C-terminal region. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit postnatal lethality, growth retardation, cardiomyocyte and skeletal myocyte degeneration, and pulmonary edema. Mice homozygous for a null allele also exhibit postnatal lethality and growth retardation but lack the myocyte degeneration phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A G 18: 6,623,952 probably null Het
Als2 A T 1: 59,180,154 D1212E possibly damaging Het
Arfgef3 A G 10: 18,619,782 S1167P probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp1b2 A G 11: 69,603,469 V66A possibly damaging Het
Boc T C 16: 44,490,618 D751G probably damaging Het
Camk1d T C 2: 5,354,776 Y145C probably benign Het
Ccdc172 G A 19: 58,536,585 R158H probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cd9 T C 6: 125,462,394 D125G possibly damaging Het
Cep295 T C 9: 15,332,538 I1493V probably benign Het
Chrna5 A G 9: 54,998,075 D57G probably benign Het
Cul7 C T 17: 46,661,312 R1201W probably damaging Het
Dnah1 A G 14: 31,262,270 V3976A probably benign Het
Dnah11 T C 12: 117,966,659 D3317G possibly damaging Het
Dnmt3b G T 2: 153,670,417 E353* probably null Het
Gch1 T C 14: 47,155,803 S241G probably benign Het
Gpr22 A T 12: 31,708,913 Y366* probably null Het
Gse1 A T 8: 120,567,764 M277L probably benign Het
Kcnt2 G A 1: 140,425,332 V260I probably damaging Het
Nbas G T 12: 13,374,826 C1022F probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr807 A T 10: 129,754,628 L274H probably damaging Het
Parp4 C A 14: 56,592,391 T274K possibly damaging Het
Pgs1 A G 11: 118,002,536 S230G probably damaging Het
Plin4 T G 17: 56,104,338 T898P probably damaging Het
Ptprj A C 2: 90,463,095 V548G probably damaging Het
Sec23a T C 12: 59,002,005 I139M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Syne1 A T 10: 5,347,870 D1142E probably benign Het
Tbccd1 A G 16: 22,825,948 V226A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmed7 A G 18: 46,593,247 probably null Het
Tnfrsf23 A T 7: 143,670,054 C137S probably damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Other mutations in Bag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Bag3 APN 7 128546341 missense probably benign 0.03
IGL01942:Bag3 APN 7 128546300 missense probably benign 0.00
PIT4377001:Bag3 UTSW 7 128545717 missense probably damaging 1.00
R0577:Bag3 UTSW 7 128523887 missense probably benign 0.00
R1730:Bag3 UTSW 7 128523859 start codon destroyed possibly damaging 0.89
R1991:Bag3 UTSW 7 128545683 missense probably benign
R2065:Bag3 UTSW 7 128545774 missense probably damaging 0.96
R2198:Bag3 UTSW 7 128545769 frame shift probably null
R2201:Bag3 UTSW 7 128545769 frame shift probably null
R3407:Bag3 UTSW 7 128545768 frame shift probably null
R3407:Bag3 UTSW 7 128545769 frame shift probably null
R3408:Bag3 UTSW 7 128545769 frame shift probably null
R3765:Bag3 UTSW 7 128540271 missense probably benign 0.30
R4430:Bag3 UTSW 7 128523923 missense probably damaging 0.99
R5642:Bag3 UTSW 7 128546106 missense probably damaging 1.00
R6112:Bag3 UTSW 7 128541832 missense probably damaging 0.99
R6298:Bag3 UTSW 7 128540198 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTGAAAGTGGAAGCCATC -3'
(R):5'- TCTCTACAGCATGGTCCCAG -3'

Sequencing Primer
(F):5'- CCTGGAGAAGGTACAAGGGCTG -3'
(R):5'- TTGCCAGCTGAGTCTGC -3'
Posted On2015-06-10