Incidental Mutation 'R4201:Gpr22'
ID318764
Institutional Source Beutler Lab
Gene Symbol Gpr22
Ensembl Gene ENSMUSG00000044067
Gene NameG protein-coupled receptor 22
Synonyms
MMRRC Submission 041031-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4201 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location31706867-31713947 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 31708913 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 366 (Y366*)
Ref Sequence ENSEMBL: ENSMUSP00000134839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862] [ENSMUST00000057783] [ENSMUST00000174480] [ENSMUST00000176710]
Predicted Effect probably benign
Transcript: ENSMUST00000036862
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000057783
AA Change: Y403*
SMART Domains Protein: ENSMUSP00000056125
Gene: ENSMUSG00000044067
AA Change: Y403*

DomainStartEndE-ValueType
low complexity region 58 64 N/A INTRINSIC
Pfam:7tm_1 95 403 2.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174480
SMART Domains Protein: ENSMUSP00000134674
Gene: ENSMUSG00000044067

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
Pfam:7tm_1 58 186 3.3e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176710
AA Change: Y366*
SMART Domains Protein: ENSMUSP00000134839
Gene: ENSMUSG00000044067
AA Change: Y366*

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
Pfam:7tm_1 58 366 1.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased response to aortic banding including decreased fractional shortening and decompensated heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A G 18: 6,623,952 probably null Het
Als2 A T 1: 59,180,154 D1212E possibly damaging Het
Arfgef3 A G 10: 18,619,782 S1167P probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp1b2 A G 11: 69,603,469 V66A possibly damaging Het
Bag3 C A 7: 128,546,157 L499I probably damaging Het
Boc T C 16: 44,490,618 D751G probably damaging Het
Camk1d T C 2: 5,354,776 Y145C probably benign Het
Ccdc172 G A 19: 58,536,585 R158H probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cd9 T C 6: 125,462,394 D125G possibly damaging Het
Cep295 T C 9: 15,332,538 I1493V probably benign Het
Chrna5 A G 9: 54,998,075 D57G probably benign Het
Cul7 C T 17: 46,661,312 R1201W probably damaging Het
Dnah1 A G 14: 31,262,270 V3976A probably benign Het
Dnah11 T C 12: 117,966,659 D3317G possibly damaging Het
Dnmt3b G T 2: 153,670,417 E353* probably null Het
Gch1 T C 14: 47,155,803 S241G probably benign Het
Gse1 A T 8: 120,567,764 M277L probably benign Het
Kcnt2 G A 1: 140,425,332 V260I probably damaging Het
Nbas G T 12: 13,374,826 C1022F probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr807 A T 10: 129,754,628 L274H probably damaging Het
Parp4 C A 14: 56,592,391 T274K possibly damaging Het
Pgs1 A G 11: 118,002,536 S230G probably damaging Het
Plin4 T G 17: 56,104,338 T898P probably damaging Het
Ptprj A C 2: 90,463,095 V548G probably damaging Het
Sec23a T C 12: 59,002,005 I139M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Syne1 A T 10: 5,347,870 D1142E probably benign Het
Tbccd1 A G 16: 22,825,948 V226A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmed7 A G 18: 46,593,247 probably null Het
Tnfrsf23 A T 7: 143,670,054 C137S probably damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Other mutations in Gpr22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Gpr22 APN 12 31708710 unclassified probably benign
IGL01521:Gpr22 APN 12 31708710 unclassified probably benign
IGL01533:Gpr22 APN 12 31708710 unclassified probably benign
IGL01585:Gpr22 APN 12 31709337 missense probably benign 0.23
IGL01601:Gpr22 APN 12 31710045 splice site probably benign
IGL01608:Gpr22 APN 12 31708780 nonsense probably null
IGL02307:Gpr22 APN 12 31708740 missense possibly damaging 0.95
IGL02440:Gpr22 APN 12 31709140 missense probably damaging 0.99
IGL02863:Gpr22 APN 12 31710007 missense probably benign 0.36
IGL03163:Gpr22 APN 12 31709172 missense possibly damaging 0.68
R0078:Gpr22 UTSW 12 31711641 missense probably benign
R0358:Gpr22 UTSW 12 31709982 missense probably benign 0.03
R0395:Gpr22 UTSW 12 31709462 missense possibly damaging 0.48
R0452:Gpr22 UTSW 12 31708794 missense possibly damaging 0.69
R0729:Gpr22 UTSW 12 31709313 missense probably damaging 1.00
R1295:Gpr22 UTSW 12 31709514 missense probably benign 0.01
R1991:Gpr22 UTSW 12 31709203 missense probably benign
R5203:Gpr22 UTSW 12 31709788 missense probably damaging 1.00
R5505:Gpr22 UTSW 12 31709725 missense probably damaging 1.00
R5541:Gpr22 UTSW 12 31709349 missense probably damaging 0.97
R6218:Gpr22 UTSW 12 31711617 nonsense probably null
R6844:Gpr22 UTSW 12 31709952 missense probably benign
R7448:Gpr22 UTSW 12 31709515 missense probably benign 0.06
R7956:Gpr22 UTSW 12 31709220 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGTCTGTGACAACCTGAGGTAC -3'
(R):5'- TCTGTAATAATTGCCCTCCGG -3'

Sequencing Primer
(F):5'- GTCTGTGACAACCTGAGGTACTAAAC -3'
(R):5'- CGGCAGAAAAGAGTCTTCAAAATGTC -3'
Posted On2015-06-10