Incidental Mutation 'R0394:Derl2'
ID31877
Institutional Source Beutler Lab
Gene Symbol Derl2
Ensembl Gene ENSMUSG00000018442
Gene NameDer1-like domain family, member 2
SynonymsFlana, CGI-101, Derlin-2, F-lana
MMRRC Submission 038600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0394 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location71007164-71019841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71014561 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 32 (F32I)
Ref Sequence ENSEMBL: ENSMUSP00000127568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018586] [ENSMUST00000108523] [ENSMUST00000131340] [ENSMUST00000132198] [ENSMUST00000143850] [ENSMUST00000171041]
Predicted Effect probably benign
Transcript: ENSMUST00000018586
SMART Domains Protein: ENSMUSP00000136261
Gene: ENSMUSG00000018442

DomainStartEndE-ValueType
Pfam:DER1 13 82 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108523
AA Change: F106I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104163
Gene: ENSMUSG00000018442
AA Change: F106I

DomainStartEndE-ValueType
Pfam:DER1 13 203 5.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131340
SMART Domains Protein: ENSMUSP00000135984
Gene: ENSMUSG00000018442

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140712
Predicted Effect probably benign
Transcript: ENSMUST00000143850
AA Change: F106I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117052
Gene: ENSMUSG00000018442
AA Change: F106I

DomainStartEndE-ValueType
Pfam:DER1 13 203 7.8e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171041
AA Change: F32I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127568
Gene: ENSMUSG00000018442
AA Change: F32I

DomainStartEndE-ValueType
Pfam:DER1 1 129 4.2e-46 PFAM
Meta Mutation Damage Score 0.0666 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER (Oda et al., 2006 [PubMed 16449189]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal lethality with surviving mice exhibiting male sterility, inverted rib cage, abnormal chondrocytes in the ribs, lethality during pregancy, cachexia, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,067,304 S751R probably damaging Het
4933417A18Rik T C 13: 34,932,653 probably benign Het
Abca8a A G 11: 110,026,343 V1610A probably damaging Het
Actl10 A T 2: 154,553,037 H202L probably benign Het
Alox12 A T 11: 70,245,935 V489E probably damaging Het
Ap4m1 T A 5: 138,172,203 F5I probably benign Het
Atn1 T C 6: 124,749,733 probably benign Het
Atrnl1 T A 19: 57,673,176 N529K probably benign Het
B3gntl1 C T 11: 121,619,715 G336D probably damaging Het
Bmp1 G A 14: 70,490,034 A703V probably damaging Het
Brat1 T G 5: 140,718,386 L798R probably damaging Het
Cacna1c C T 6: 118,625,497 G1302R probably damaging Het
Cdr2 A T 7: 120,958,731 D190E probably benign Het
Cenpe T C 3: 135,216,425 probably benign Het
Clstn1 A G 4: 149,644,178 D687G probably benign Het
Coro1a A G 7: 126,700,640 F337L probably benign Het
Ddx49 T A 8: 70,296,925 I252F probably damaging Het
Dennd2a T A 6: 39,522,812 D273V possibly damaging Het
Dmrta1 A G 4: 89,692,039 Y412C probably damaging Het
Dsg1a A G 18: 20,333,750 N559S probably damaging Het
Dusp26 G T 8: 31,091,959 R27L probably benign Het
Eif2ak3 T C 6: 70,885,218 I492T probably benign Het
Exoc7 G T 11: 116,300,398 Q219K probably damaging Het
F2r T C 13: 95,604,476 T184A probably damaging Het
Fbf1 G A 11: 116,152,462 probably benign Het
Fbxo28 A G 1: 182,317,015 M328T probably benign Het
Fsip2 T A 2: 82,991,075 D5717E possibly damaging Het
Gnpat C A 8: 124,880,225 S373R possibly damaging Het
Golgb1 G T 16: 36,875,579 probably benign Het
Greb1l T C 18: 10,523,374 V844A probably damaging Het
Hps1 G T 19: 42,770,899 probably null Het
Inppl1 G T 7: 101,828,195 probably benign Het
Isca1 C T 13: 59,758,885 probably null Het
Itgb2 T A 10: 77,542,475 C46S probably damaging Het
Kifc5b C T 17: 26,923,082 T178M probably benign Het
Krt80 T C 15: 101,352,299 T22A probably damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Ltbp2 C T 12: 84,806,424 probably benign Het
Mettl18 A G 1: 163,996,341 D77G probably benign Het
Mfsd2a A G 4: 122,950,168 L336P probably benign Het
Mgat4b A G 11: 50,230,919 probably null Het
Mtmr14 C T 6: 113,280,688 R233* probably null Het
Nbea T C 3: 56,029,907 Y761C probably damaging Het
Neb A T 2: 52,177,559 probably null Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Olfr814 T A 10: 129,873,942 I272L probably benign Het
Oxr1 T A 15: 41,817,197 M177K probably damaging Het
Pgm2l1 A G 7: 100,252,198 Y98C probably damaging Het
Pi4kb G T 3: 94,996,804 probably benign Het
Pi4kb G A 3: 94,996,805 probably benign Het
Pirb T A 7: 3,719,248 S199C probably benign Het
Prss23 A C 7: 89,509,847 I338S probably damaging Het
Rapgef3 A T 15: 97,757,819 probably benign Het
Rdh7 T A 10: 127,884,670 T278S probably benign Het
Rnf219 T C 14: 104,478,853 R695G possibly damaging Het
Rrp1b A G 17: 32,058,564 D606G probably benign Het
Rxfp1 T A 3: 79,652,377 Y379F possibly damaging Het
Rxfp2 T C 5: 150,067,388 V514A probably benign Het
Scel A T 14: 103,562,518 E202V probably benign Het
Slc25a36 G A 9: 97,080,204 A244V probably benign Het
Slc2a13 T G 15: 91,516,392 Q209P probably damaging Het
Slc38a6 A G 12: 73,352,530 N456S probably benign Het
Slc6a12 G T 6: 121,346,998 probably null Het
Spag6l T C 16: 16,780,629 I333V probably benign Het
Spen G A 4: 141,474,203 A2371V probably benign Het
St6galnac1 T C 11: 116,766,640 D366G probably damaging Het
Stk33 T C 7: 109,341,489 S5G probably benign Het
Tle2 T C 10: 81,577,648 L84P probably damaging Het
Tmem14a T C 1: 21,226,652 M78T probably damaging Het
Top2b T A 14: 16,413,556 probably null Het
Trmt13 A G 3: 116,582,650 F364S probably damaging Het
Unkl T A 17: 25,230,777 probably null Het
Uvrag A G 7: 99,004,719 probably benign Het
Vmn2r8 T A 5: 108,802,072 N303I probably benign Het
Vsig10l A G 7: 43,465,455 N360S probably damaging Het
Zdhhc25 T C 15: 88,600,920 Y153H probably damaging Het
Zfp646 T C 7: 127,883,262 V1537A possibly damaging Het
Zfp664 T A 5: 124,886,065 Y174* probably null Het
Other mutations in Derl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00803:Derl2 APN 11 71013454 missense probably benign 0.31
IGL01338:Derl2 APN 11 71010355 missense possibly damaging 0.61
IGL02727:Derl2 APN 11 71013210 splice site probably benign
R0751:Derl2 UTSW 11 71014547 splice site probably null
R1507:Derl2 UTSW 11 71007345 missense probably benign
R1860:Derl2 UTSW 11 71018343 missense probably damaging 1.00
R5138:Derl2 UTSW 11 71014564 nonsense probably null
R5207:Derl2 UTSW 11 71019247 unclassified probably null
R5965:Derl2 UTSW 11 71014552 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGTAGCTCCCGAGGCTACAATC -3'
(R):5'- AGTGACTGGAACGGTGTTCATGC -3'

Sequencing Primer
(F):5'- AGGCTACAATCTGGAGGTCTATG -3'
(R):5'- ATCCCAGTGAGACAGGCTTTG -3'
Posted On2013-04-24