Incidental Mutation 'R4201:Boc'
ID318771
Institutional Source Beutler Lab
Gene Symbol Boc
Ensembl Gene ENSMUSG00000022687
Gene Namebiregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein
Synonyms
MMRRC Submission 041031-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4201 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44485049-44558897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44490618 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 751 (D751G)
Ref Sequence ENSEMBL: ENSMUSP00000110281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114634]
Predicted Effect probably damaging
Transcript: ENSMUST00000023370
AA Change: D751G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023370
Gene: ENSMUSG00000022687
AA Change: D751G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114634
AA Change: D751G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110281
Gene: ENSMUSG00000022687
AA Change: D751G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin/fibronectin type III repeat family. It is a component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells, and promotes myogenic differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a null mutation display abnormal commissural axon projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A G 18: 6,623,952 probably null Het
Als2 A T 1: 59,180,154 D1212E possibly damaging Het
Arfgef3 A G 10: 18,619,782 S1167P probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp1b2 A G 11: 69,603,469 V66A possibly damaging Het
Bag3 C A 7: 128,546,157 L499I probably damaging Het
Camk1d T C 2: 5,354,776 Y145C probably benign Het
Ccdc172 G A 19: 58,536,585 R158H probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cd9 T C 6: 125,462,394 D125G possibly damaging Het
Cep295 T C 9: 15,332,538 I1493V probably benign Het
Chrna5 A G 9: 54,998,075 D57G probably benign Het
Cul7 C T 17: 46,661,312 R1201W probably damaging Het
Dnah1 A G 14: 31,262,270 V3976A probably benign Het
Dnah11 T C 12: 117,966,659 D3317G possibly damaging Het
Dnmt3b G T 2: 153,670,417 E353* probably null Het
Gch1 T C 14: 47,155,803 S241G probably benign Het
Gpr22 A T 12: 31,708,913 Y366* probably null Het
Gse1 A T 8: 120,567,764 M277L probably benign Het
Kcnt2 G A 1: 140,425,332 V260I probably damaging Het
Nbas G T 12: 13,374,826 C1022F probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr807 A T 10: 129,754,628 L274H probably damaging Het
Parp4 C A 14: 56,592,391 T274K possibly damaging Het
Pgs1 A G 11: 118,002,536 S230G probably damaging Het
Plin4 T G 17: 56,104,338 T898P probably damaging Het
Ptprj A C 2: 90,463,095 V548G probably damaging Het
Sec23a T C 12: 59,002,005 I139M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Syne1 A T 10: 5,347,870 D1142E probably benign Het
Tbccd1 A G 16: 22,825,948 V226A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmed7 A G 18: 46,593,247 probably null Het
Tnfrsf23 A T 7: 143,670,054 C137S probably damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Other mutations in Boc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Boc APN 16 44492955 missense probably benign 0.00
IGL00981:Boc APN 16 44491801 missense probably damaging 0.99
IGL01820:Boc APN 16 44491872 missense possibly damaging 0.88
IGL03114:Boc APN 16 44486752 missense probably benign 0.38
IGL03195:Boc APN 16 44492821 missense probably damaging 0.99
R0006:Boc UTSW 16 44496449 missense probably benign 0.41
R0142:Boc UTSW 16 44490241 missense probably damaging 1.00
R0417:Boc UTSW 16 44520234 missense probably benign 0.16
R1066:Boc UTSW 16 44490684 critical splice acceptor site probably null
R1248:Boc UTSW 16 44520473 missense probably benign 0.03
R1438:Boc UTSW 16 44488746 splice site probably null
R1506:Boc UTSW 16 44503565 missense probably damaging 1.00
R1729:Boc UTSW 16 44496419 missense probably benign 0.00
R1784:Boc UTSW 16 44496419 missense probably benign 0.00
R2004:Boc UTSW 16 44501644 critical splice donor site probably null
R2441:Boc UTSW 16 44488623 missense probably damaging 1.00
R2863:Boc UTSW 16 44492960 missense probably benign 0.03
R3885:Boc UTSW 16 44487613 splice site probably benign
R4239:Boc UTSW 16 44491884 missense probably damaging 1.00
R4382:Boc UTSW 16 44491182 missense probably damaging 1.00
R4384:Boc UTSW 16 44491182 missense probably damaging 1.00
R4385:Boc UTSW 16 44491182 missense probably damaging 1.00
R4684:Boc UTSW 16 44500380 missense probably benign 0.07
R4776:Boc UTSW 16 44487721 missense probably damaging 0.99
R4788:Boc UTSW 16 44500433 missense probably damaging 1.00
R4830:Boc UTSW 16 44490157 missense probably damaging 1.00
R5000:Boc UTSW 16 44490154 missense probably damaging 1.00
R5567:Boc UTSW 16 44492824 missense probably damaging 1.00
R5570:Boc UTSW 16 44492824 missense probably damaging 1.00
R5645:Boc UTSW 16 44499661 missense probably damaging 0.99
R5651:Boc UTSW 16 44521195 missense probably benign 0.00
R5881:Boc UTSW 16 44490651 missense probably damaging 1.00
R6021:Boc UTSW 16 44488654 missense probably benign 0.00
R6085:Boc UTSW 16 44488607 missense probably damaging 1.00
R6188:Boc UTSW 16 44499548 missense possibly damaging 0.67
R6295:Boc UTSW 16 44492348 missense probably benign 0.05
R6366:Boc UTSW 16 44487652 missense probably benign 0.04
R6626:Boc UTSW 16 44520440 missense possibly damaging 0.47
R6629:Boc UTSW 16 44492361 missense probably benign 0.11
R6707:Boc UTSW 16 44500616 missense possibly damaging 0.71
R6819:Boc UTSW 16 44492825 missense probably damaging 0.99
R6904:Boc UTSW 16 44491791 missense probably damaging 1.00
R7260:Boc UTSW 16 44490170 missense
R7353:Boc UTSW 16 44485737 missense unknown
R7458:Boc UTSW 16 44486756 missense
R7671:Boc UTSW 16 44491849 missense
Predicted Primers PCR Primer
(F):5'- AGCTCCACGTGTGTCATAAGG -3'
(R):5'- ATCTCTGCAGCCTTCTTCAGAG -3'

Sequencing Primer
(F):5'- ACGTGTGTCATAAGGGACCCAC -3'
(R):5'- TCAGAGAACCTGAGGGACTTATTC -3'
Posted On2015-06-10