Mutagenetix > Incidental Mutation

Incidental Mutation 'R4202:Cfap65'

318779

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

041032-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.720) question?

Stock #

R4202 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74941230-74974758 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 74959701 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 816 (F816L)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: F816L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: F816L

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139950

Meta Mutation Damage Score

0.3688

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

92% (33/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adsl	C	T	15: 80,836,417 (GRCm39)	T58I	probably damaging	Het
Ano7	A	G	1: 93,308,200 (GRCm39)	D77G	probably benign	Het
Ap2b1	T	A	11: 83,226,430 (GRCm39)		probably null	Het
Bclaf3	T	A	X: 158,336,829 (GRCm39)	S419T	probably damaging	Het
Bysl	A	G	17: 47,915,251 (GRCm39)	S166P	probably benign	Het
Cd101	A	C	3: 100,926,001 (GRCm39)	D239E	probably damaging	Het
Cdc42bpb	G	A	12: 111,260,573 (GRCm39)	P1702S	probably benign	Het
Cnot6	T	C	11: 49,593,463 (GRCm39)	Y6C	probably damaging	Het
Csrp1	T	G	1: 135,673,065 (GRCm39)	C61G	probably damaging	Het
Gmeb2	A	G	2: 180,895,766 (GRCm39)	V468A	possibly damaging	Het
Gucy2g	A	G	19: 55,218,201 (GRCm39)	S416P	possibly damaging	Het
Hormad1	G	A	3: 95,492,509 (GRCm39)	R362H	probably benign	Het
Lancl2	T	A	6: 57,689,977 (GRCm39)	V61D	probably benign	Het
Lta4h	A	G	10: 93,306,669 (GRCm39)	D287G	probably damaging	Het
Maml1	A	T	11: 50,148,740 (GRCm39)	L1000Q	probably damaging	Het
Or6c206	T	C	10: 129,097,646 (GRCm39)	V272A	probably benign	Het
Or7a42	T	C	10: 78,791,129 (GRCm39)	V30A	probably benign	Het
Osbpl9	G	T	4: 109,029,437 (GRCm39)		probably benign	Het
Oser1	T	C	2: 163,253,375 (GRCm39)	T45A	probably benign	Het
Pip4p1	A	G	14: 51,168,112 (GRCm39)	S41P	probably damaging	Het
Ppfibp1	C	A	6: 146,931,079 (GRCm39)	S878R	probably damaging	Het
Prss43	T	A	9: 110,656,529 (GRCm39)	V72D	probably benign	Het
Sdhb	T	A	4: 140,706,379 (GRCm39)	M272K	possibly damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Stx17	T	A	4: 48,158,870 (GRCm39)	D83E	probably damaging	Het
Tas2r138	T	C	6: 40,589,410 (GRCm39)	M279V	possibly damaging	Het
Tsku	C	T	7: 98,002,205 (GRCm39)	R42H	probably damaging	Het
Tyr	A	G	7: 87,078,276 (GRCm39)	L528P	possibly damaging	Het
Vmn2r87	T	C	10: 130,308,448 (GRCm39)	I597V	probably benign	Het
Wnt5b	T	C	6: 119,417,272 (GRCm39)	N198D	probably damaging	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74,958,342 (GRCm39)	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74,950,237 (GRCm39)	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74,966,353 (GRCm39)	missense	probably benign
IGL01780:Cfap65	APN	1	74,967,507 (GRCm39)	nonsense	probably null
IGL01993:Cfap65	APN	1	74,959,702 (GRCm39)	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74,967,304 (GRCm39)	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74,967,507 (GRCm39)	nonsense	probably null
IGL02357:Cfap65	APN	1	74,967,507 (GRCm39)	nonsense	probably null
IGL02576:Cfap65	APN	1	74,942,617 (GRCm39)	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74,944,239 (GRCm39)	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74,966,337 (GRCm39)	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74,950,267 (GRCm39)	nonsense	probably null
IGL03101:Cfap65	APN	1	74,967,592 (GRCm39)	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74,966,778 (GRCm39)	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74,943,801 (GRCm39)	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74,967,501 (GRCm39)	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74,971,077 (GRCm39)	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74,971,117 (GRCm39)	nonsense	probably null
R0281:Cfap65	UTSW	1	74,966,230 (GRCm39)	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74,943,226 (GRCm39)	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74,968,461 (GRCm39)	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74,968,460 (GRCm39)	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74,965,603 (GRCm39)	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74,959,760 (GRCm39)	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74,964,599 (GRCm39)	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74,956,043 (GRCm39)	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74,957,603 (GRCm39)	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74,941,328 (GRCm39)	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74,958,046 (GRCm39)	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74,943,841 (GRCm39)	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74,960,678 (GRCm39)	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74,944,872 (GRCm39)	missense	probably damaging	0.99
R1079:Cfap65	UTSW	1	74,941,606 (GRCm39)	missense	probably damaging	0.98
R1083:Cfap65	UTSW	1	74,957,663 (GRCm39)	splice site	probably benign
R1159:Cfap65	UTSW	1	74,968,499 (GRCm39)	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74,964,263 (GRCm39)	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74,956,334 (GRCm39)	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74,958,107 (GRCm39)	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74,946,819 (GRCm39)	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74,956,358 (GRCm39)	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74,946,850 (GRCm39)	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74,956,432 (GRCm39)	frame shift	probably null
R2219:Cfap65	UTSW	1	74,943,184 (GRCm39)	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74,943,184 (GRCm39)	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74,965,634 (GRCm39)	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74,966,345 (GRCm39)	small insertion	probably benign
R3114:Cfap65	UTSW	1	74,966,291 (GRCm39)	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74,966,840 (GRCm39)	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74,942,517 (GRCm39)	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74,946,771 (GRCm39)	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74,946,771 (GRCm39)	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74,943,215 (GRCm39)	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74,964,513 (GRCm39)	intron	probably benign
R4701:Cfap65	UTSW	1	74,958,067 (GRCm39)	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74,967,520 (GRCm39)	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74,966,791 (GRCm39)	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74,956,454 (GRCm39)	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74,964,716 (GRCm39)	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74,958,420 (GRCm39)	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74,946,772 (GRCm39)	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74,942,283 (GRCm39)	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74,945,495 (GRCm39)	nonsense	probably null
R5074:Cfap65	UTSW	1	74,962,137 (GRCm39)	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74,945,600 (GRCm39)	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74,965,675 (GRCm39)	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74,964,061 (GRCm39)	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74,942,334 (GRCm39)	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74,964,259 (GRCm39)	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74,946,677 (GRCm39)	intron	probably benign
R5669:Cfap65	UTSW	1	74,964,127 (GRCm39)	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74,962,190 (GRCm39)	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74,959,564 (GRCm39)	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74,942,298 (GRCm39)	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74,966,868 (GRCm39)	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74,943,844 (GRCm39)	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74,956,445 (GRCm39)	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74,971,180 (GRCm39)	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74,964,274 (GRCm39)	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74,971,058 (GRCm39)	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74,965,792 (GRCm39)	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74,965,763 (GRCm39)	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74,960,742 (GRCm39)	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74,959,585 (GRCm39)	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74,965,769 (GRCm39)	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74,941,593 (GRCm39)	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74,972,303 (GRCm39)	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74,967,527 (GRCm39)	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74,965,784 (GRCm39)	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74,972,321 (GRCm39)	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74,949,902 (GRCm39)	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74,956,328 (GRCm39)	nonsense	probably null
R8431:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74,967,203 (GRCm39)	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74,945,096 (GRCm39)	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74,942,382 (GRCm39)	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74,941,347 (GRCm39)	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74,959,552 (GRCm39)	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74,943,847 (GRCm39)	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74,958,510 (GRCm39)	splice site	probably benign
R9187:Cfap65	UTSW	1	74,956,517 (GRCm39)	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74,959,567 (GRCm39)	missense	probably benign
R9212:Cfap65	UTSW	1	74,959,567 (GRCm39)	missense	probably benign
R9273:Cfap65	UTSW	1	74,960,769 (GRCm39)	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74,944,210 (GRCm39)	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74,945,468 (GRCm39)	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74,946,537 (GRCm39)	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74,958,501 (GRCm39)	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74,943,840 (GRCm39)	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74,944,806 (GRCm39)	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74,949,906 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGCCACAGGACTAGTAAGAC -3'
(R):5'- TCATGTGAAAATCAGCACGGATAG -3'

Sequencing Primer
(F):5'- TAAAGGTGACAGGTACCCTCCTTG -3'
(R):5'- AGAGGTCATGGCATTGTC -3'

Posted On

2015-06-10