Incidental Mutation 'R4202:Tsku'
ID318795
Institutional Source Beutler Lab
Gene Symbol Tsku
Ensembl Gene ENSMUSG00000049580
Gene Nametsukushi, small leucine rich proteoglycan
Synonyms9530051K01Rik, Lrrc54
MMRRC Submission 041032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4202 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location98350668-98361328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98352998 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 42 (R42H)
Ref Sequence ENSEMBL: ENSMUSP00000146025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094161] [ENSMUST00000164726] [ENSMUST00000165257] [ENSMUST00000165901] [ENSMUST00000167405] [ENSMUST00000179780] [ENSMUST00000206414]
Predicted Effect probably damaging
Transcript: ENSMUST00000094161
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091713
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164726
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130917
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165257
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128431
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165901
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127242
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167405
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131789
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179780
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137437
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206414
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206770
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (33/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a failure of anterior commissure axons to cross the midline. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl C T 15: 80,952,216 T58I probably damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Ap2b1 T A 11: 83,335,604 probably null Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Bysl A G 17: 47,604,326 S166P probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Cfap65 G T 1: 74,920,542 F816L probably damaging Het
Cnot6 T C 11: 49,702,636 Y6C probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Gucy2g A G 19: 55,229,769 S416P possibly damaging Het
Hormad1 G A 3: 95,585,198 R362H probably benign Het
Lancl2 T A 6: 57,712,992 V61D probably benign Het
Lta4h A G 10: 93,470,807 D287G probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr8 T C 10: 78,955,295 V30A probably benign Het
Osbpl9 G T 4: 109,172,240 probably benign Het
Oser1 T C 2: 163,411,455 T45A probably benign Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Prss43 T A 9: 110,827,461 V72D probably benign Het
Sdhb T A 4: 140,979,068 M272K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tas2r138 T C 6: 40,612,476 M279V possibly damaging Het
Tmem55b A G 14: 50,930,655 S41P probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Wnt5b T C 6: 119,440,311 N198D probably damaging Het
Other mutations in Tsku
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0034:Tsku UTSW 7 98352663 missense possibly damaging 0.70
R0034:Tsku UTSW 7 98352663 missense possibly damaging 0.70
R1560:Tsku UTSW 7 98352944 missense probably damaging 1.00
R1745:Tsku UTSW 7 98352179 missense possibly damaging 0.80
R1994:Tsku UTSW 7 98352146 missense probably damaging 1.00
R2899:Tsku UTSW 7 98352917 missense probably damaging 1.00
R3429:Tsku UTSW 7 98352539 missense probably damaging 1.00
R3430:Tsku UTSW 7 98352539 missense probably damaging 1.00
R4205:Tsku UTSW 7 98352998 missense probably damaging 0.99
R4206:Tsku UTSW 7 98352998 missense probably damaging 0.99
R4373:Tsku UTSW 7 98352831 missense probably benign 0.01
R5782:Tsku UTSW 7 98352850 missense probably damaging 0.99
R5818:Tsku UTSW 7 98352098 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCAAGTGACTCCAGGTAGC -3'
(R):5'- GTCTCTTATAGGCCAGGATGC -3'

Sequencing Primer
(F):5'- TGACTCCAGGTAGCGCAGTC -3'
(R):5'- CCAGGATGCCAGTGTCTG -3'
Posted On2015-06-10