Incidental Mutation 'R4202:Cnot6'
ID318801
Institutional Source Beutler Lab
Gene Symbol Cnot6
Ensembl Gene ENSMUSG00000020362
Gene NameCCR4-NOT transcription complex, subunit 6
SynonymsA230103N10Rik
MMRRC Submission 041032-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R4202 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49671503-49712723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49702636 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 6 (Y6C)
Ref Sequence ENSEMBL: ENSMUSP00000121239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020624] [ENSMUST00000145353]
Predicted Effect probably damaging
Transcript: ENSMUST00000020624
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020624
Gene: ENSMUSG00000020362
AA Change: Y6C

DomainStartEndE-ValueType
LRR 50 72 1.41e0 SMART
LRR_TYP 73 95 2.71e-2 SMART
LRR_TYP 96 119 1.67e-2 SMART
Pfam:Exo_endo_phos 187 526 1.9e-23 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120146
Predicted Effect probably damaging
Transcript: ENSMUST00000145353
AA Change: Y6C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121239
Gene: ENSMUSG00000020362
AA Change: Y6C

DomainStartEndE-ValueType
LRR 50 72 1.41e0 SMART
LRR_TYP 73 95 2.71e-2 SMART
LRR_TYP 96 119 1.67e-2 SMART
Pfam:Exo_endo_phos 192 531 1.9e-23 PFAM
low complexity region 534 547 N/A INTRINSIC
Meta Mutation Damage Score 0.4165 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (33/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic component of the CCR4-NOT core transcriptional regulation complex. The encoded protein has a 3'-5' RNase activity and prefers polyadenylated substrates. The CCR4-NOT complex plays a role in many cellular processes, including miRNA-mediated repression, mRNA degradation, and transcriptional regulation. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl C T 15: 80,952,216 T58I probably damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Ap2b1 T A 11: 83,335,604 probably null Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Bysl A G 17: 47,604,326 S166P probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Cfap65 G T 1: 74,920,542 F816L probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Gucy2g A G 19: 55,229,769 S416P possibly damaging Het
Hormad1 G A 3: 95,585,198 R362H probably benign Het
Lancl2 T A 6: 57,712,992 V61D probably benign Het
Lta4h A G 10: 93,470,807 D287G probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr8 T C 10: 78,955,295 V30A probably benign Het
Osbpl9 G T 4: 109,172,240 probably benign Het
Oser1 T C 2: 163,411,455 T45A probably benign Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Prss43 T A 9: 110,827,461 V72D probably benign Het
Sdhb T A 4: 140,979,068 M272K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tas2r138 T C 6: 40,612,476 M279V possibly damaging Het
Tmem55b A G 14: 50,930,655 S41P probably damaging Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Wnt5b T C 6: 119,440,311 N198D probably damaging Het
Other mutations in Cnot6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Cnot6 APN 11 49685266 missense probably benign 0.01
IGL00969:Cnot6 APN 11 49685120 missense probably benign
IGL01655:Cnot6 APN 11 49677304 missense probably damaging 1.00
IGL02074:Cnot6 APN 11 49689243 missense probably benign 0.00
IGL02670:Cnot6 APN 11 49685114 nonsense probably null
R0326:Cnot6 UTSW 11 49677436 missense probably damaging 1.00
R0625:Cnot6 UTSW 11 49683171 missense probably damaging 1.00
R1079:Cnot6 UTSW 11 49685103 missense probably benign 0.01
R3820:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R3821:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R3822:Cnot6 UTSW 11 49689172 missense probably benign 0.04
R4515:Cnot6 UTSW 11 49702536 splice site probably null
R6010:Cnot6 UTSW 11 49683239 nonsense probably null
R6193:Cnot6 UTSW 11 49680023 missense probably benign 0.06
R7149:Cnot6 UTSW 11 49680143 missense probably benign
R7501:Cnot6 UTSW 11 49685332 missense probably benign 0.01
R7556:Cnot6 UTSW 11 49675317 missense probably benign 0.15
R8263:Cnot6 UTSW 11 49682175 missense probably damaging 0.99
RF003:Cnot6 UTSW 11 49702613 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTAAAGTACCGCTGTTGCTC -3'
(R):5'- CTCCAGGGTTTAATCAGCCATATCC -3'

Sequencing Primer
(F):5'- GCTGTTGCTCTTCTACATGCAGTAG -3'
(R):5'- GGGTTTAATCAGCCATATCCTAGAAC -3'
Posted On2015-06-10