Incidental Mutation 'R4202:Adsl'
ID318806
Institutional Source Beutler Lab
Gene Symbol Adsl
Ensembl Gene ENSMUSG00000022407
Gene Nameadenylosuccinate lyase
Synonyms
MMRRC Submission 041032-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4202 (G1)
Quality Score189
Status Validated
Chromosome15
Chromosomal Location80948490-80970946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80952216 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 58 (T58I)
Ref Sequence ENSEMBL: ENSMUSP00000132423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023043] [ENSMUST00000164806] [ENSMUST00000166711] [ENSMUST00000168756] [ENSMUST00000169238] [ENSMUST00000170354] [ENSMUST00000200201] [ENSMUST00000207170]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023043
AA Change: T58I

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023043
Gene: ENSMUSG00000022407
AA Change: T58I

DomainStartEndE-ValueType
Pfam:Lyase_1 49 313 4.4e-29 PFAM
ADSL_C 377 461 5.65e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164371
Predicted Effect possibly damaging
Transcript: ENSMUST00000164806
AA Change: T58I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131998
Gene: ENSMUSG00000022407
AA Change: T58I

DomainStartEndE-ValueType
Pfam:Lyase_1 47 313 8.4e-29 PFAM
Blast:ADSL_C 377 416 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000166711
AA Change: T58I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129601
Gene: ENSMUSG00000022407
AA Change: T58I

DomainStartEndE-ValueType
PDB:2VD6|D 1 134 3e-87 PDB
SCOP:d1c3ca_ 20 134 9e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168756
AA Change: T58I

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127593
Gene: ENSMUSG00000022407
AA Change: T58I

DomainStartEndE-ValueType
Pfam:Lyase_1 115 298 3.9e-25 PFAM
ADSL_C 362 446 5.65e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169238
AA Change: T58I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132423
Gene: ENSMUSG00000022407
AA Change: T58I

DomainStartEndE-ValueType
PDB:2VD6|D 1 134 3e-87 PDB
SCOP:d1c3ca_ 20 134 9e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170354
AA Change: T8I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198302
Predicted Effect probably damaging
Transcript: ENSMUST00000200201
AA Change: T58I

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143188
Gene: ENSMUSG00000022407
AA Change: T58I

DomainStartEndE-ValueType
PDB:2VD6|D 1 119 6e-77 PDB
SCOP:d1c3ca_ 20 119 4e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207170
Meta Mutation Damage Score 0.3237 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (33/36)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in adenosine monophosphate (AMP) biosynthesis and maintaining AMP levels in the muscle. The encoded enzyme catalyzes the release of fumarate during AMP biosynthesis by cleaving the substrates succinylaminoimidazole carboxamide (SAICA) ribotide to give aminoimidazole carboxamide (AICA) ribotide, and adenylosuccinate to give adenylate. In humans, this gene is associated with adenylosuccinate deficiency, a rare autosomal disorder resulting in a spectrum of neurological symptoms. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 A G 1: 93,380,478 D77G probably benign Het
Ap2b1 T A 11: 83,335,604 probably null Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Bysl A G 17: 47,604,326 S166P probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Cfap65 G T 1: 74,920,542 F816L probably damaging Het
Cnot6 T C 11: 49,702,636 Y6C probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Gucy2g A G 19: 55,229,769 S416P possibly damaging Het
Hormad1 G A 3: 95,585,198 R362H probably benign Het
Lancl2 T A 6: 57,712,992 V61D probably benign Het
Lta4h A G 10: 93,470,807 D287G probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr8 T C 10: 78,955,295 V30A probably benign Het
Osbpl9 G T 4: 109,172,240 probably benign Het
Oser1 T C 2: 163,411,455 T45A probably benign Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Prss43 T A 9: 110,827,461 V72D probably benign Het
Sdhb T A 4: 140,979,068 M272K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tas2r138 T C 6: 40,612,476 M279V possibly damaging Het
Tmem55b A G 14: 50,930,655 S41P probably damaging Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Wnt5b T C 6: 119,440,311 N198D probably damaging Het
Other mutations in Adsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Adsl APN 15 80948700 missense probably null 0.24
IGL02249:Adsl APN 15 80960475 missense probably benign 0.26
IGL03009:Adsl APN 15 80952243 nonsense probably null
R0046:Adsl UTSW 15 80962788 critical splice donor site probably null
R0046:Adsl UTSW 15 80962788 critical splice donor site probably null
R0194:Adsl UTSW 15 80961360 missense possibly damaging 0.91
R0575:Adsl UTSW 15 80963685 missense probably damaging 1.00
R1111:Adsl UTSW 15 80967660 missense probably damaging 1.00
R1606:Adsl UTSW 15 80952224 nonsense probably null
R1822:Adsl UTSW 15 80962742 nonsense probably null
R2152:Adsl UTSW 15 80967662 missense probably damaging 1.00
R2284:Adsl UTSW 15 80963895 missense probably damaging 0.99
R4008:Adsl UTSW 15 80966156 missense probably benign 0.05
R4010:Adsl UTSW 15 80966156 missense probably benign 0.05
R4011:Adsl UTSW 15 80966156 missense probably benign 0.05
R4587:Adsl UTSW 15 80967767 critical splice donor site probably null
R5053:Adsl UTSW 15 80960450 missense probably damaging 1.00
R5086:Adsl UTSW 15 80963700 missense probably damaging 0.96
R5123:Adsl UTSW 15 80952294 unclassified probably null
R5187:Adsl UTSW 15 80948905 intron probably benign
R5416:Adsl UTSW 15 80952183 splice site probably null
R5532:Adsl UTSW 15 80963909 missense probably damaging 1.00
R5898:Adsl UTSW 15 80961353 splice site probably null
R7401:Adsl UTSW 15 80962782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAATTCCTCCATGCTTTTGAAC -3'
(R):5'- CTCCGACATAGCAGGAGGTG -3'

Sequencing Primer
(F):5'- TACAGATGGTTGTGAGCCACC -3'
(R):5'- TGGCGCCCAGATGAATAATGC -3'
Posted On2015-06-10