Incidental Mutation 'R4204:Abca1'
ID318822
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission 041033-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4204 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53090369 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 360 (K360R)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably benign
Transcript: ENSMUST00000030010
AA Change: K360R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: K360R

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Meta Mutation Damage Score 0.0678 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,544 R1363* probably null Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
B130006D01Rik A G 11: 95,726,424 probably benign Het
BC028528 A T 3: 95,889,745 Y37* probably null Het
Ccdc171 A T 4: 83,681,155 M736L probably benign Het
Ccdc88a A G 11: 29,463,399 K646E probably damaging Het
Fam83b T C 9: 76,503,053 T192A probably benign Het
Hgs C A 11: 120,477,187 P241T probably damaging Het
Itga4 T C 2: 79,279,161 Y235H probably damaging Het
Kank2 A G 9: 21,795,627 Y32H probably damaging Het
Kprp A C 3: 92,824,739 S335A probably damaging Het
Lgals9 C T 11: 78,969,816 probably benign Het
Mfrp G A 9: 44,105,228 G407S possibly damaging Het
Mfsd9 C T 1: 40,781,510 G160R probably damaging Het
Mkl2 A T 16: 13,403,255 Q776L possibly damaging Het
Mtcl1 T C 17: 66,438,261 Y35C probably damaging Het
Nhej1 A T 1: 75,046,623 I6N probably damaging Het
Npy5r G T 8: 66,682,041 Y33* probably null Het
Olfr1225 A G 2: 89,170,780 V144A probably benign Het
Pcdha8 G C 18: 36,994,684 V740L probably damaging Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Ppp2r2b T A 18: 42,738,050 H62L probably benign Het
Prodh A G 16: 18,072,318 V553A probably damaging Het
Rasgef1c G A 11: 49,958,708 V137M probably benign Het
Rgl2 G T 17: 33,936,932 V694L probably benign Het
Rnf133 T C 6: 23,649,049 N294D probably benign Het
Rpe65 G A 3: 159,604,410 A107T probably damaging Het
Sacs A G 14: 61,173,443 R56G possibly damaging Het
Serp2 A G 14: 76,556,462 I18T probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sis T C 3: 72,961,082 I92V probably benign Het
Tcaim A G 9: 122,833,618 K417R probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmem132c A G 5: 127,563,765 D1000G possibly damaging Het
Trpm3 T A 19: 22,987,564 D1474E probably benign Het
Ubxn2a T C 12: 4,894,593 E43G probably damaging Het
Utp14b G A 1: 78,664,822 E146K probably benign Het
Zfp800 C T 6: 28,243,181 S595N probably benign Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
R7793:Abca1 UTSW 4 53042367 missense not run
R7863:Abca1 UTSW 4 53107179 missense probably benign
R7877:Abca1 UTSW 4 53046135 missense possibly damaging 0.55
R7946:Abca1 UTSW 4 53107179 missense probably benign
R7960:Abca1 UTSW 4 53046135 missense possibly damaging 0.55
R8010:Abca1 UTSW 4 53127600
R8058:Abca1 UTSW 4 53081954
RF005:Abca1 UTSW 4 53049125 missense probably damaging 0.97
RF024:Abca1 UTSW 4 53049125 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Z1177:Abca1 UTSW 4 53079584
Z1177:Abca1 UTSW 4 53080799
Z1177:Abca1 UTSW 4 53086133
Predicted Primers PCR Primer
(F):5'- TGAAGCTGCGTTCACTTCC -3'
(R):5'- TTTCGAGCACTGAGGAAAGACC -3'

Sequencing Primer
(F):5'- AAGCTGCGTTCACTTCCTACCC -3'
(R):5'- CACAGCTCTGACAAGTGGATGTTAC -3'
Posted On2015-06-10