Incidental Mutation 'R4204:Npy5r'
ID318830
Institutional Source Beutler Lab
Gene Symbol Npy5r
Ensembl Gene ENSMUSG00000044014
Gene Nameneuropeptide Y receptor Y5
SynonymsY5R
MMRRC Submission 041033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4204 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location66679965-66688128 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 66682041 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 33 (Y33*)
Ref Sequence ENSEMBL: ENSMUSP00000148589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070810] [ENSMUST00000211920] [ENSMUST00000212563]
Predicted Effect probably null
Transcript: ENSMUST00000070810
AA Change: Y33*
SMART Domains Protein: ENSMUSP00000065157
Gene: ENSMUSG00000044014
AA Change: Y33*

DomainStartEndE-ValueType
internal_repeat_1 15 36 1.53e-7 PROSPERO
internal_repeat_1 36 57 1.53e-7 PROSPERO
Pfam:7TM_GPCR_Srsx 73 253 1.9e-10 PFAM
Pfam:7tm_1 79 445 2.9e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211920
AA Change: Y33*
Predicted Effect probably null
Transcript: ENSMUST00000212563
AA Change: Y33*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for neuropeptide Y and peptide YY. The encoded protein appears to be involved in regulating food intake, with defects in this gene being associated with eating disorders. Also, the encoded protein is involved in a pathway that protects neuroblastoma cells from chemotherapy-induced cell death, providing a possible therapeutic target against neuroblastoma. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show increased susceptibility to diet-induced obesity and a reduced orexigenic response to select agonists. Homozygotes for a reporter allele show mild late-onset obesity, increased adiposity, polyphagia, and exacerbated obesity parameters after chronic NPY infusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,544 R1363* probably null Het
Abca1 T C 4: 53,090,369 K360R probably benign Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
B130006D01Rik A G 11: 95,726,424 probably benign Het
BC028528 A T 3: 95,889,745 Y37* probably null Het
Ccdc171 A T 4: 83,681,155 M736L probably benign Het
Ccdc88a A G 11: 29,463,399 K646E probably damaging Het
Fam83b T C 9: 76,503,053 T192A probably benign Het
Hgs C A 11: 120,477,187 P241T probably damaging Het
Itga4 T C 2: 79,279,161 Y235H probably damaging Het
Kank2 A G 9: 21,795,627 Y32H probably damaging Het
Kprp A C 3: 92,824,739 S335A probably damaging Het
Lgals9 C T 11: 78,969,816 probably benign Het
Mfrp G A 9: 44,105,228 G407S possibly damaging Het
Mfsd9 C T 1: 40,781,510 G160R probably damaging Het
Mkl2 A T 16: 13,403,255 Q776L possibly damaging Het
Mtcl1 T C 17: 66,438,261 Y35C probably damaging Het
Nhej1 A T 1: 75,046,623 I6N probably damaging Het
Olfr1225 A G 2: 89,170,780 V144A probably benign Het
Pcdha8 G C 18: 36,994,684 V740L probably damaging Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Ppp2r2b T A 18: 42,738,050 H62L probably benign Het
Prodh A G 16: 18,072,318 V553A probably damaging Het
Rasgef1c G A 11: 49,958,708 V137M probably benign Het
Rgl2 G T 17: 33,936,932 V694L probably benign Het
Rnf133 T C 6: 23,649,049 N294D probably benign Het
Rpe65 G A 3: 159,604,410 A107T probably damaging Het
Sacs A G 14: 61,173,443 R56G possibly damaging Het
Serp2 A G 14: 76,556,462 I18T probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sis T C 3: 72,961,082 I92V probably benign Het
Tcaim A G 9: 122,833,618 K417R probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmem132c A G 5: 127,563,765 D1000G possibly damaging Het
Trpm3 T A 19: 22,987,564 D1474E probably benign Het
Ubxn2a T C 12: 4,894,593 E43G probably damaging Het
Utp14b G A 1: 78,664,822 E146K probably benign Het
Zfp800 C T 6: 28,243,181 S595N probably benign Het
Other mutations in Npy5r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Npy5r APN 8 66681866 missense possibly damaging 0.47
IGL02192:Npy5r APN 8 66681346 missense probably benign 0.02
oleo UTSW 8 66682041 nonsense probably null
roly-poly UTSW 8 66681540 frame shift probably null
R0395:Npy5r UTSW 8 66681973 missense probably benign 0.21
R1547:Npy5r UTSW 8 66681034 missense possibly damaging 0.52
R1616:Npy5r UTSW 8 66681400 missense probably damaging 1.00
R1906:Npy5r UTSW 8 66681473 missense probably damaging 1.00
R1965:Npy5r UTSW 8 66681277 missense probably benign
R2443:Npy5r UTSW 8 66681290 nonsense probably null
R4087:Npy5r UTSW 8 66682045 missense probably damaging 0.98
R4404:Npy5r UTSW 8 66681992 missense probably benign 0.01
R5427:Npy5r UTSW 8 66681020 missense probably damaging 0.98
R5530:Npy5r UTSW 8 66680860 missense probably benign 0.06
R5994:Npy5r UTSW 8 66682099 missense probably benign 0.06
R6041:Npy5r UTSW 8 66682023 missense possibly damaging 0.72
R6602:Npy5r UTSW 8 66681540 frame shift probably null
R6837:Npy5r UTSW 8 66681740 missense probably benign 0.00
R7879:Npy5r UTSW 8 66681316 missense possibly damaging 0.92
R7923:Npy5r UTSW 8 66681752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTAGTCTTCTGATTGCGC -3'
(R):5'- GCCCTTTGTGATCCTAGAGG -3'

Sequencing Primer
(F):5'- GATTGCGCTTTTTCATAACAGC -3'
(R):5'- TGATCCTAGAGGTTTGTAAGAGAATG -3'
Posted On2015-06-10