Incidental Mutation 'R4204:Rgl2'
ID318847
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Nameral guanine nucleotide dissociation stimulator-like 2
SynonymsKE1.5, Rab2l, Rgt2, Rlf
MMRRC Submission 041033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R4204 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33929543-33937687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33936932 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 694 (V694L)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000174426] [ENSMUST00000179418]
PDB Structure
STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: V694L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: V694L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect unknown
Transcript: ENSMUST00000173284
AA Change: V246L
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: V246L

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Meta Mutation Damage Score 0.1646 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,544 R1363* probably null Het
Abca1 T C 4: 53,090,369 K360R probably benign Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
B130006D01Rik A G 11: 95,726,424 probably benign Het
BC028528 A T 3: 95,889,745 Y37* probably null Het
Ccdc171 A T 4: 83,681,155 M736L probably benign Het
Ccdc88a A G 11: 29,463,399 K646E probably damaging Het
Fam83b T C 9: 76,503,053 T192A probably benign Het
Hgs C A 11: 120,477,187 P241T probably damaging Het
Itga4 T C 2: 79,279,161 Y235H probably damaging Het
Kank2 A G 9: 21,795,627 Y32H probably damaging Het
Kprp A C 3: 92,824,739 S335A probably damaging Het
Lgals9 C T 11: 78,969,816 probably benign Het
Mfrp G A 9: 44,105,228 G407S possibly damaging Het
Mfsd9 C T 1: 40,781,510 G160R probably damaging Het
Mkl2 A T 16: 13,403,255 Q776L possibly damaging Het
Mtcl1 T C 17: 66,438,261 Y35C probably damaging Het
Nhej1 A T 1: 75,046,623 I6N probably damaging Het
Npy5r G T 8: 66,682,041 Y33* probably null Het
Olfr1225 A G 2: 89,170,780 V144A probably benign Het
Pcdha8 G C 18: 36,994,684 V740L probably damaging Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Ppp2r2b T A 18: 42,738,050 H62L probably benign Het
Prodh A G 16: 18,072,318 V553A probably damaging Het
Rasgef1c G A 11: 49,958,708 V137M probably benign Het
Rnf133 T C 6: 23,649,049 N294D probably benign Het
Rpe65 G A 3: 159,604,410 A107T probably damaging Het
Sacs A G 14: 61,173,443 R56G possibly damaging Het
Serp2 A G 14: 76,556,462 I18T probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sis T C 3: 72,961,082 I92V probably benign Het
Tcaim A G 9: 122,833,618 K417R probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmem132c A G 5: 127,563,765 D1000G possibly damaging Het
Trpm3 T A 19: 22,987,564 D1474E probably benign Het
Ubxn2a T C 12: 4,894,593 E43G probably damaging Het
Utp14b G A 1: 78,664,822 E146K probably benign Het
Zfp800 C T 6: 28,243,181 S595N probably benign Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 33933136 missense probably benign 0.31
IGL00898:Rgl2 APN 17 33933418 missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 33935936 missense probably benign 0.00
IGL00985:Rgl2 APN 17 33932101 missense probably damaging 1.00
IGL02140:Rgl2 APN 17 33933124 missense probably damaging 1.00
IGL02214:Rgl2 APN 17 33935189 missense probably benign 0.06
IGL02486:Rgl2 APN 17 33935980 missense probably damaging 0.97
IGL02579:Rgl2 APN 17 33937160 missense probably benign 0.08
IGL02976:Rgl2 APN 17 33933962 missense possibly damaging 0.95
Pedernales UTSW 17 33932038 critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 33933940 missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 33932738 missense probably damaging 1.00
R0456:Rgl2 UTSW 17 33936849 splice site probably null
R0825:Rgl2 UTSW 17 33935159 splice site probably null
R1742:Rgl2 UTSW 17 33937223 unclassified probably null
R1777:Rgl2 UTSW 17 33931744 missense probably benign 0.00
R1829:Rgl2 UTSW 17 33933621 missense probably benign 0.00
R1908:Rgl2 UTSW 17 33932148 missense probably benign 0.00
R1961:Rgl2 UTSW 17 33933615 missense probably damaging 1.00
R2102:Rgl2 UTSW 17 33933340 splice site probably null
R3001:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3002:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3755:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3756:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3978:Rgl2 UTSW 17 33935162 missense probably benign 0.02
R4042:Rgl2 UTSW 17 33937262 missense probably damaging 1.00
R4064:Rgl2 UTSW 17 33937108 missense possibly damaging 0.77
R4661:Rgl2 UTSW 17 33933226 missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 33937173 missense probably benign 0.00
R4922:Rgl2 UTSW 17 33932775 unclassified probably benign
R5119:Rgl2 UTSW 17 33937120 missense probably benign 0.00
R5167:Rgl2 UTSW 17 33935974 nonsense probably null
R5279:Rgl2 UTSW 17 33935948 missense probably benign
R5319:Rgl2 UTSW 17 33933555 missense probably benign 0.02
R5337:Rgl2 UTSW 17 33934984 missense probably damaging 0.99
R5881:Rgl2 UTSW 17 33932717 missense probably benign 0.01
R5945:Rgl2 UTSW 17 33932038 critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 33931765 missense probably benign 0.01
R6358:Rgl2 UTSW 17 33937131 unclassified probably null
R6867:Rgl2 UTSW 17 33932687 missense probably benign 0.09
R7174:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7203:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7250:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7253:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7455:Rgl2 UTSW 17 33932683 missense probably benign 0.32
R7513:Rgl2 UTSW 17 33932555 missense probably benign
R7752:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7984:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
X0028:Rgl2 UTSW 17 33932458 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACGGGAAACAGGTCATCATG -3'
(R):5'- CCATGGCATAGAAGACGTTAGC -3'

Sequencing Primer
(F):5'- TGGGTAGCCCTGTACATCCTAG -3'
(R):5'- CATAGAAGACGTTAGCTGAGTGTG -3'
Posted On2015-06-10