Incidental Mutation 'R4204:Tex11'
ID 318852
Institutional Source Beutler Lab
Gene Symbol Tex11
Ensembl Gene ENSMUSG00000009670
Gene Name testis expressed gene 11
Synonyms 4930565P14Rik
MMRRC Submission 041033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R4204 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 100838648-101059667 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100933415 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 487 (A487S)
Ref Sequence ENSEMBL: ENSMUSP00000109347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009814] [ENSMUST00000113716] [ENSMUST00000113718]
AlphaFold Q14AT2
Predicted Effect possibly damaging
Transcript: ENSMUST00000009814
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000009814
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 176 431 1.1e-62 PFAM
low complexity region 702 713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113716
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109345
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 175 433 2.1e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113718
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109347
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 175 433 3.8e-70 PFAM
low complexity region 702 713 N/A INTRINSIC
Meta Mutation Damage Score 0.3188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is X-linked and is expressed in only male germ cells. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Miche homozygous for a knockout allele exhibit abnormal male meiosis. Mice homozygous for a conditional knockout exhibit male infertility and reduced female fecundity due to abnormal meiosis following cre recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,544 R1363* probably null Het
Abca1 T C 4: 53,090,369 K360R probably benign Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
B130006D01Rik A G 11: 95,726,424 probably benign Het
BC028528 A T 3: 95,889,745 Y37* probably null Het
Ccdc171 A T 4: 83,681,155 M736L probably benign Het
Ccdc88a A G 11: 29,463,399 K646E probably damaging Het
Fam83b T C 9: 76,503,053 T192A probably benign Het
Hgs C A 11: 120,477,187 P241T probably damaging Het
Itga4 T C 2: 79,279,161 Y235H probably damaging Het
Kank2 A G 9: 21,795,627 Y32H probably damaging Het
Kprp A C 3: 92,824,739 S335A probably damaging Het
Lgals9 C T 11: 78,969,816 probably benign Het
Mfrp G A 9: 44,105,228 G407S possibly damaging Het
Mfsd9 C T 1: 40,781,510 G160R probably damaging Het
Mkl2 A T 16: 13,403,255 Q776L possibly damaging Het
Mtcl1 T C 17: 66,438,261 Y35C probably damaging Het
Nhej1 A T 1: 75,046,623 I6N probably damaging Het
Npy5r G T 8: 66,682,041 Y33* probably null Het
Olfr1225 A G 2: 89,170,780 V144A probably benign Het
Pcdha8 G C 18: 36,994,684 V740L probably damaging Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Ppp2r2b T A 18: 42,738,050 H62L probably benign Het
Prodh A G 16: 18,072,318 V553A probably damaging Het
Rasgef1c G A 11: 49,958,708 V137M probably benign Het
Rgl2 G T 17: 33,936,932 V694L probably benign Het
Rnf133 T C 6: 23,649,049 N294D probably benign Het
Rpe65 G A 3: 159,604,410 A107T probably damaging Het
Sacs A G 14: 61,173,443 R56G possibly damaging Het
Serp2 A G 14: 76,556,462 I18T probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sis T C 3: 72,961,082 I92V probably benign Het
Tcaim A G 9: 122,833,618 K417R probably benign Het
Tmem132c A G 5: 127,563,765 D1000G possibly damaging Het
Trpm3 T A 19: 22,987,564 D1474E probably benign Het
Ubxn2a T C 12: 4,894,593 E43G probably damaging Het
Utp14b G A 1: 78,664,822 E146K probably benign Het
Zfp800 C T 6: 28,243,181 S595N probably benign Het
Other mutations in Tex11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Tex11 APN X 101032559 missense probably null 0.00
IGL00838:Tex11 APN X 100972118 missense possibly damaging 0.92
IGL02385:Tex11 APN X 100876529 splice site probably benign
R2958:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R2960:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R2963:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3008:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3009:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3010:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3011:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3745:Tex11 UTSW X 100916572 missense probably benign 0.33
R3881:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3882:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4081:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4082:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4159:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4172:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4197:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4201:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4206:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4304:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4305:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R8726:Tex11 UTSW X 101015585 missense possibly damaging 0.82
R8727:Tex11 UTSW X 101015585 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GATGGTTTCCCGAATTCTTGTC -3'
(R):5'- GAGTACTCCTCAACAATTGTGTC -3'

Sequencing Primer
(F):5'- CTTGTCCAATATTTGCCCATTTAAG -3'
(R):5'- GCCATAGCAGAAGTTGAG -3'
Posted On 2015-06-10