Incidental Mutation 'R4205:Gm13762'
ID318857
Institutional Source Beutler Lab
Gene Symbol Gm13762
Ensembl Gene ENSMUSG00000075111
Gene Namepredicted gene 13762
Synonyms
MMRRC Submission 041034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4205 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88972055-88980281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88973138 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 251 (V251A)
Ref Sequence ENSEMBL: ENSMUSP00000126588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099806] [ENSMUST00000144908] [ENSMUST00000168169]
Predicted Effect probably benign
Transcript: ENSMUST00000099806
AA Change: V251A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097394
Gene: ENSMUSG00000101480
AA Change: V251A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7tm_1 39 286 3.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131574
Predicted Effect probably benign
Transcript: ENSMUST00000144908
AA Change: V251A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000168169
AA Change: V251A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126588
Gene: ENSMUSG00000075111
AA Change: V251A

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 1.8e-26 PFAM
Pfam:7tm_4 138 282 3.3e-36 PFAM
Meta Mutation Damage Score 0.4315 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Elavl1 A G 8: 4,289,851 W244R probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Fam20c T G 5: 138,755,676 L14R probably damaging Het
Glt1d1 G T 5: 127,689,871 R217L probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Taar9 C T 10: 24,108,579 R319H possibly damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Zc3h13 A G 14: 75,327,601 D718G unknown Het
Other mutations in Gm13762
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0240:Gm13762 UTSW 2 88973396 missense probably damaging 1.00
R1446:Gm13762 UTSW 2 88973765 missense probably benign 0.00
R1845:Gm13762 UTSW 2 88973138 missense probably benign 0.22
R1868:Gm13762 UTSW 2 88973784 missense possibly damaging 0.60
R1953:Gm13762 UTSW 2 88973880 nonsense probably null
R4751:Gm13762 UTSW 2 88973133 missense probably damaging 1.00
R4895:Gm13762 UTSW 2 88973711 missense probably benign 0.39
R4937:Gm13762 UTSW 2 88973490 missense probably damaging 1.00
R5621:Gm13762 UTSW 2 88973466 missense probably benign 0.00
R5678:Gm13762 UTSW 2 88972973 nonsense probably null
R5938:Gm13762 UTSW 2 88973013 missense probably benign 0.00
R6021:Gm13762 UTSW 2 88973032 nonsense probably null
R6180:Gm13762 UTSW 2 88973882 missense probably damaging 1.00
R6724:Gm13762 UTSW 2 88973268 missense probably benign 0.02
R6873:Gm13762 UTSW 2 88973424 missense probably benign
R6893:Gm13762 UTSW 2 88973799 missense probably benign 0.00
R7221:Gm13762 UTSW 2 88973153 missense probably damaging 0.99
R7634:Gm13762 UTSW 2 88973657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGTACATATCCTTGAACATGTG -3'
(R):5'- TGAAGCTTGCCTGCACTGAC -3'

Sequencing Primer
(F):5'- GTATACCCACTGGAAACTGACTGTG -3'
(R):5'- GCCTGCACTGACACATATATTTTTG -3'
Posted On2015-06-10