Incidental Mutation 'R4205:Glt1d1'
ID318864
Institutional Source Beutler Lab
Gene Symbol Glt1d1
Ensembl Gene ENSMUSG00000049971
Gene Nameglycosyltransferase 1 domain containing 1
Synonyms5730455A04Rik
MMRRC Submission 041034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4205 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location127632262-127709374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 127689871 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 217 (R217L)
Ref Sequence ENSEMBL: ENSMUSP00000113864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118139]
Predicted Effect probably benign
Transcript: ENSMUST00000118139
AA Change: R217L

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113864
Gene: ENSMUSG00000049971
AA Change: R217L

DomainStartEndE-ValueType
Pfam:Glycos_transf_1 153 319 8.2e-23 PFAM
Pfam:Glyco_trans_1_4 166 305 8.7e-15 PFAM
Pfam:Glyco_trans_1_2 244 335 8.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137157
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Elavl1 A G 8: 4,289,851 W244R probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Fam20c T G 5: 138,755,676 L14R probably damaging Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Taar9 C T 10: 24,108,579 R319H possibly damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Zc3h13 A G 14: 75,327,601 D718G unknown Het
Other mutations in Glt1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Glt1d1 APN 5 127632285 start codon destroyed probably null 1.00
IGL01310:Glt1d1 APN 5 127632320 missense possibly damaging 0.86
IGL01608:Glt1d1 APN 5 127664682 missense possibly damaging 0.56
IGL01738:Glt1d1 APN 5 127632355 intron probably benign
IGL02028:Glt1d1 APN 5 127706920 missense possibly damaging 0.63
IGL02273:Glt1d1 APN 5 127657144 splice site probably benign
IGL02603:Glt1d1 APN 5 127632345 missense probably damaging 1.00
IGL02718:Glt1d1 APN 5 127650699 missense probably damaging 0.98
IGL02850:Glt1d1 APN 5 127644345 missense probably benign 0.00
IGL03328:Glt1d1 APN 5 127657119 missense probably benign
R0049:Glt1d1 UTSW 5 127663327 splice site probably benign
R0312:Glt1d1 UTSW 5 127691070 missense probably damaging 1.00
R0400:Glt1d1 UTSW 5 127657075 splice site probably benign
R1838:Glt1d1 UTSW 5 127678129 missense probably benign 0.01
R2060:Glt1d1 UTSW 5 127657119 missense probably benign
R2262:Glt1d1 UTSW 5 127657112 missense probably benign 0.08
R3776:Glt1d1 UTSW 5 127694311 missense probably damaging 1.00
R4249:Glt1d1 UTSW 5 127691112 critical splice donor site probably null
R4379:Glt1d1 UTSW 5 127694282 missense possibly damaging 0.73
R5044:Glt1d1 UTSW 5 127644414 missense probably benign 0.38
R5289:Glt1d1 UTSW 5 127644356 missense probably benign 0.11
R5374:Glt1d1 UTSW 5 127657084 splice site probably null
R5533:Glt1d1 UTSW 5 127691031 missense probably damaging 1.00
R5592:Glt1d1 UTSW 5 127657119 missense probably benign 0.01
R5870:Glt1d1 UTSW 5 127677280 missense probably damaging 1.00
R5942:Glt1d1 UTSW 5 127644470 splice site probably null
R6128:Glt1d1 UTSW 5 127677271 missense probably damaging 1.00
R6349:Glt1d1 UTSW 5 127706886 missense probably benign 0.10
R6490:Glt1d1 UTSW 5 127644296 intron probably null
R6502:Glt1d1 UTSW 5 127706981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCACCTGCATAATTGG -3'
(R):5'- ACCCAAAGCATGACCTTGG -3'

Sequencing Primer
(F):5'- CACACGTCATGGTGCATATG -3'
(R):5'- CTTGGGAGGTCACAGGGAAC -3'
Posted On2015-06-10