Incidental Mutation 'R4205:Fam20c'
ID318865
Institutional Source Beutler Lab
Gene Symbol Fam20c
Ensembl Gene ENSMUSG00000025854
Gene Namefamily with sequence similarity 20, member C
SynonymsDMP4
MMRRC Submission 041034-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R4205 (G1)
Quality Score205
Status Validated
Chromosome5
Chromosomal Location138754514-138810077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 138755676 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 14 (L14R)
Ref Sequence ENSEMBL: ENSMUSP00000124584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026972] [ENSMUST00000160645]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026972
AA Change: L14R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026972
Gene: ENSMUSG00000025854
AA Change: L14R

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
Pfam:Fam20C 349 565 4.5e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160645
AA Change: L14R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124584
Gene: ENSMUSG00000025854
AA Change: L14R

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197027
Meta Mutation Damage Score 0.3177 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of secreted protein kinases. The encoded protein binds calcium and phosphorylates proteins involved in bone mineralization. Mutations in this gene are associated with the autosomal recessive disorder Raine syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice with global conditional deletion of this gene display infertility, dwarfism, delayed bone ossification, reduced bone mineralization, fragile skeletons, hypophosphatemic rickets, and impaired osteoblast differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Elavl1 A G 8: 4,289,851 W244R probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Glt1d1 G T 5: 127,689,871 R217L probably benign Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Taar9 C T 10: 24,108,579 R319H possibly damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Zc3h13 A G 14: 75,327,601 D718G unknown Het
Other mutations in Fam20c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fam20c APN 5 138809157 missense probably benign
IGL01096:Fam20c APN 5 138809155 missense possibly damaging 0.93
IGL01393:Fam20c APN 5 138807271 missense probably damaging 1.00
IGL01576:Fam20c APN 5 138807339 missense probably damaging 0.98
IGL01960:Fam20c APN 5 138806320 missense probably damaging 0.99
IGL02317:Fam20c APN 5 138806360 missense probably damaging 1.00
IGL02979:Fam20c APN 5 138757865 missense probably damaging 1.00
IGL02988:Fam20c UTSW 5 138755994 missense probably benign 0.20
R0197:Fam20c UTSW 5 138755724 missense probably damaging 1.00
R0594:Fam20c UTSW 5 138766637 missense possibly damaging 0.94
R0615:Fam20c UTSW 5 138807486 missense probably damaging 0.99
R1672:Fam20c UTSW 5 138807301 missense probably damaging 1.00
R2044:Fam20c UTSW 5 138756227 critical splice donor site probably null
R2484:Fam20c UTSW 5 138809117 missense probably benign
R3418:Fam20c UTSW 5 138757868 missense probably damaging 0.99
R3419:Fam20c UTSW 5 138757868 missense probably damaging 0.99
R5966:Fam20c UTSW 5 138756177 missense probably damaging 1.00
R6346:Fam20c UTSW 5 138766695 missense probably damaging 1.00
R7290:Fam20c UTSW 5 138807554 missense probably damaging 1.00
R7559:Fam20c UTSW 5 138793199 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTCACGACGTCCAAGTCTG -3'
(R):5'- AGCTGAAGTCTTGCAGGATG -3'

Sequencing Primer
(F):5'- CACTGAATGGACCTTGAC -3'
(R):5'- TTGTTGGGCCAGCCTGC -3'
Posted On2015-06-10