Incidental Mutation 'R4205:Arhgef5'
ID 318866
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission 041034-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4205 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43250766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 506 (T506A)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect possibly damaging
Transcript: ENSMUST00000031750
AA Change: T506A

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: T506A

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Meta Mutation Damage Score 0.0881 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acte1 G T 7: 143,422,964 (GRCm39) V17L probably damaging Het
Akap13 T C 7: 75,260,667 (GRCm39) I294T probably benign Het
Alpk2 G A 18: 65,438,282 (GRCm39) T1037M possibly damaging Het
Ano7 A G 1: 93,308,200 (GRCm39) D77G probably benign Het
Bclaf3 T A X: 158,336,829 (GRCm39) S419T probably damaging Het
Cd101 A C 3: 100,926,001 (GRCm39) D239E probably damaging Het
Cdhr1 G T 14: 36,802,461 (GRCm39) F667L probably benign Het
Csrp1 T G 1: 135,673,065 (GRCm39) C61G probably damaging Het
Dmrtc2 C T 7: 24,575,231 (GRCm39) Q275* probably null Het
Dsg1b A T 18: 20,541,878 (GRCm39) D795V probably damaging Het
Elavl1 A G 8: 4,339,851 (GRCm39) W244R probably damaging Het
Emilin1 T C 5: 31,077,243 (GRCm39) probably benign Het
Fam20c T G 5: 138,741,431 (GRCm39) L14R probably damaging Het
Glt1d1 G T 5: 127,766,935 (GRCm39) R217L probably benign Het
Klk14 G A 7: 43,344,358 (GRCm39) R223H probably benign Het
Lrrc26 G T 2: 25,180,170 (GRCm39) C57F probably damaging Het
Maml1 A T 11: 50,148,740 (GRCm39) L1000Q probably damaging Het
Map2 A G 1: 66,464,449 (GRCm39) Y125C probably damaging Het
Mapk1 T C 16: 16,856,321 (GRCm39) probably benign Het
Mocos G A 18: 24,799,248 (GRCm39) V161M possibly damaging Het
Or4c108 A G 2: 88,803,482 (GRCm39) V251A probably benign Het
Pcdhgb5 A G 18: 37,865,716 (GRCm39) N504D possibly damaging Het
Pcx G A 19: 4,669,194 (GRCm39) V731M possibly damaging Het
Ppfibp1 C A 6: 146,931,079 (GRCm39) S878R probably damaging Het
Ptprh C A 7: 4,600,991 (GRCm39) G129W probably damaging Het
Rasal1 T C 5: 120,797,628 (GRCm39) V120A probably benign Het
Rpl31-ps17 C T 12: 54,748,397 (GRCm39) noncoding transcript Het
Rtn4rl1 A T 11: 75,156,809 (GRCm39) I414F probably damaging Het
Rtn4rl1 C A 11: 75,156,818 (GRCm39) P417T probably damaging Het
Shank3 T C 15: 89,387,521 (GRCm39) L230P probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Taar9 C T 10: 23,984,477 (GRCm39) R319H possibly damaging Het
Tbck T A 3: 132,543,789 (GRCm39) I880N probably benign Het
Tsku C T 7: 98,002,205 (GRCm39) R42H probably damaging Het
Tyr A G 7: 87,078,276 (GRCm39) L528P possibly damaging Het
Zc3h13 A G 14: 75,565,041 (GRCm39) D718G unknown Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGGAACTGAGCCCTCAAG -3'
(R):5'- TAGCTGCTAAGAGGGCTGTG -3'

Sequencing Primer
(F):5'- CTCAAGCTCCTGCACTGG -3'
(R):5'- TCAGAGGTGGCACATGGGTAC -3'
Posted On 2015-06-10