Incidental Mutation 'R4205:Tyr'
ID318872
Institutional Source Beutler Lab
Gene Symbol Tyr
Ensembl Gene ENSMUSG00000004651
Gene Nametyrosinase
SynonymsOca1, skc35
MMRRC Submission 041034-MU
Accession Numbers

Ncbi RefSeq: NM_011661.4; MGI:98880

Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R4205 (G1)
Quality Score200
Status Validated
Chromosome7
Chromosomal Location87424771-87493512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87429068 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 528 (L528P)
Ref Sequence ENSEMBL: ENSMUSP00000004770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004770]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004770
AA Change: L528P

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004770
Gene: ENSMUSG00000004651
AA Change: L528P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
Pfam:Tyrosinase 170 403 4.8e-45 PFAM
transmembrane domain 474 496 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
Allele List at MGI

All alleles(120) : Targeted(2) Spontaneous(28) Chemically induced(16) Radiation induced(78

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Elavl1 A G 8: 4,289,851 W244R probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Fam20c T G 5: 138,755,676 L14R probably damaging Het
Glt1d1 G T 5: 127,689,871 R217L probably benign Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Taar9 C T 10: 24,108,579 R319H possibly damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Zc3h13 A G 14: 75,327,601 D718G unknown Het
Other mutations in Tyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Tyr APN 7 87437948 missense probably damaging 1.00
IGL01594:Tyr APN 7 87483814 splice site probably benign
IGL02963:Tyr APN 7 87483997 missense probably benign
IGL03356:Tyr APN 7 87492714 missense possibly damaging 0.71
ghost UTSW 7 87472495 missense probably damaging 1.00
pale_rider UTSW 7 87438023 missense probably damaging 1.00
rufus UTSW 7 87492706 missense probably damaging 1.00
siamese UTSW 7 87438044 missense probably damaging 0.99
Venusaur UTSW 7 87492706 missense probably damaging 1.00
waffle UTSW 7 87493221 missense possibly damaging 0.94
R0322:Tyr UTSW 7 87492917 missense probably benign 0.35
R0479:Tyr UTSW 7 87493221 missense possibly damaging 0.94
R1544:Tyr UTSW 7 87492706 missense probably damaging 1.00
R1546:Tyr UTSW 7 87437992 missense probably benign 0.02
R1606:Tyr UTSW 7 87437971 missense probably benign 0.01
R1666:Tyr UTSW 7 87492941 missense probably damaging 1.00
R2064:Tyr UTSW 7 87492843 missense probably benign 0.13
R2213:Tyr UTSW 7 87492878 missense probably damaging 1.00
R2420:Tyr UTSW 7 87429189 missense probably benign 0.17
R4013:Tyr UTSW 7 87437940 missense probably benign 0.00
R4014:Tyr UTSW 7 87437940 missense probably benign 0.00
R4015:Tyr UTSW 7 87437940 missense probably benign 0.00
R4016:Tyr UTSW 7 87437940 missense probably benign 0.00
R4202:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4206:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4361:Tyr UTSW 7 87429076 missense probably benign 0.01
R4738:Tyr UTSW 7 87492647 missense probably null 1.00
R5306:Tyr UTSW 7 87438014 missense probably damaging 1.00
R5378:Tyr UTSW 7 87472495 missense probably damaging 1.00
R5395:Tyr UTSW 7 87472490 missense probably damaging 0.98
R5782:Tyr UTSW 7 87493016 missense probably damaging 1.00
R7007:Tyr UTSW 7 87493340 missense probably benign 0.04
R7609:Tyr UTSW 7 87483884 missense probably benign 0.06
R7767:Tyr UTSW 7 87493010 missense probably benign 0.37
R7794:Tyr UTSW 7 87483820 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCAGTCATTTCTTAGAAACTAGG -3'
(R):5'- TGGTGATATCTGTGAAAACAGCTTG -3'

Sequencing Primer
(F):5'- CCAACAAATAGGTCGAGTG -3'
(R):5'- CTGTGAAAACAGCTTGATCTCTTTC -3'
Posted On2015-06-10