Incidental Mutation 'R4205:Tsku'
ID318873
Institutional Source Beutler Lab
Gene Symbol Tsku
Ensembl Gene ENSMUSG00000049580
Gene Nametsukushi, small leucine rich proteoglycan
Synonyms9530051K01Rik, Lrrc54
MMRRC Submission 041034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4205 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location98350668-98361328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98352998 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 42 (R42H)
Ref Sequence ENSEMBL: ENSMUSP00000146025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094161] [ENSMUST00000164726] [ENSMUST00000165257] [ENSMUST00000165901] [ENSMUST00000167405] [ENSMUST00000179780] [ENSMUST00000206414]
Predicted Effect probably damaging
Transcript: ENSMUST00000094161
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091713
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164726
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130917
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165257
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128431
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165901
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127242
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167405
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131789
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179780
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137437
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206414
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206770
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a failure of anterior commissure axons to cross the midline. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Elavl1 A G 8: 4,289,851 W244R probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Fam20c T G 5: 138,755,676 L14R probably damaging Het
Glt1d1 G T 5: 127,689,871 R217L probably benign Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Taar9 C T 10: 24,108,579 R319H possibly damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Zc3h13 A G 14: 75,327,601 D718G unknown Het
Other mutations in Tsku
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0034:Tsku UTSW 7 98352663 missense possibly damaging 0.70
R0034:Tsku UTSW 7 98352663 missense possibly damaging 0.70
R1560:Tsku UTSW 7 98352944 missense probably damaging 1.00
R1745:Tsku UTSW 7 98352179 missense possibly damaging 0.80
R1994:Tsku UTSW 7 98352146 missense probably damaging 1.00
R2899:Tsku UTSW 7 98352917 missense probably damaging 1.00
R3429:Tsku UTSW 7 98352539 missense probably damaging 1.00
R3430:Tsku UTSW 7 98352539 missense probably damaging 1.00
R4202:Tsku UTSW 7 98352998 missense probably damaging 0.99
R4206:Tsku UTSW 7 98352998 missense probably damaging 0.99
R4373:Tsku UTSW 7 98352831 missense probably benign 0.01
R5782:Tsku UTSW 7 98352850 missense probably damaging 0.99
R5818:Tsku UTSW 7 98352098 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTGGTGAGCAGGTTGTAAC -3'
(R):5'- CAAGTTCCAGCTGTGTCCCTAC -3'

Sequencing Primer
(F):5'- TGAGCAGGTTGTAACTGAGATCC -3'
(R):5'- CTGTCTCTTATAGGCCAGGATGC -3'
Posted On2015-06-10