Incidental Mutation 'R4205:Elavl1'
ID318875
Institutional Source Beutler Lab
Gene Symbol Elavl1
Ensembl Gene ENSMUSG00000040028
Gene NameELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R)
SynonymsW91709, 2410055N02Rik, Hua, HuR
MMRRC Submission 041034-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4205 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location4285382-4325413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4289851 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 244 (W244R)
Ref Sequence ENSEMBL: ENSMUSP00000146866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098950] [ENSMUST00000209010]
Predicted Effect probably damaging
Transcript: ENSMUST00000098950
AA Change: W244R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096549
Gene: ENSMUSG00000040028
AA Change: W244R

DomainStartEndE-ValueType
RRM 21 94 1.3e-22 SMART
RRM 107 182 1.91e-20 SMART
RRM 245 318 6.15e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209010
AA Change: W244R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.8594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ELAVL family of RNA-binding proteins that contain several RNA recognition motifs, and selectively bind AU-rich elements (AREs) found in the 3' untranslated regions of mRNAs. AREs signal degradation of mRNAs as a means to regulate gene expression, thus by binding AREs, the ELAVL family of proteins play a role in stabilizing ARE-containing mRNAs. This gene has been implicated in a variety of biological processes and has been linked to a number of diseases, including cancer. It is highly expressed in many cancers, and could be potentially useful in cancer diagnosis, prognosis, and therapy. [provided by RefSeq, Sep 2012]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation and midgestational lethality due to placental failure resulting from extraembryonic trophoblast defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Fam20c T G 5: 138,755,676 L14R probably damaging Het
Glt1d1 G T 5: 127,689,871 R217L probably benign Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Taar9 C T 10: 24,108,579 R319H possibly damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Zc3h13 A G 14: 75,327,601 D718G unknown Het
Other mutations in Elavl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Elavl1 APN 8 4301699 missense probably damaging 1.00
IGL02409:Elavl1 APN 8 4289838 missense possibly damaging 0.88
R0759:Elavl1 UTSW 8 4289815 missense probably damaging 1.00
R2322:Elavl1 UTSW 8 4289802 missense probably damaging 1.00
R4946:Elavl1 UTSW 8 4301752 missense probably benign 0.05
R5009:Elavl1 UTSW 8 4301723 missense probably benign 0.00
R5073:Elavl1 UTSW 8 4301741 missense possibly damaging 0.79
R6614:Elavl1 UTSW 8 4289818 missense probably damaging 1.00
R7200:Elavl1 UTSW 8 4311767 missense probably benign 0.00
R7204:Elavl1 UTSW 8 4311712 missense probably damaging 0.98
R7305:Elavl1 UTSW 8 4325199 unclassified probably benign
R7881:Elavl1 UTSW 8 4311763 missense probably damaging 1.00
R7903:Elavl1 UTSW 8 4301756 missense probably benign 0.28
R7964:Elavl1 UTSW 8 4311763 missense probably damaging 1.00
R7986:Elavl1 UTSW 8 4301756 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GCTATGGCCATTGCAGCTTC -3'
(R):5'- CTTGAGCATCTCCAGCTCAG -3'

Sequencing Primer
(F):5'- ATGGCCATTGCAGCTTCTTCATAG -3'
(R):5'- ATGAGAGGCCCAAGTGTCCTTAC -3'
Posted On2015-06-10