Incidental Mutation 'R4205:Taar9'
ID318876
Institutional Source Beutler Lab
Gene Symbol Taar9
Ensembl Gene ENSMUSG00000037424
Gene Nametrace amine-associated receptor 9
SynonymsTar3, Ta3, Trar3
MMRRC Submission 041034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4205 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24108488-24109534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24108579 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 319 (R319H)
Ref Sequence ENSEMBL: ENSMUSP00000043552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041180]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041180
AA Change: R319H

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043552
Gene: ENSMUSG00000037424
AA Change: R319H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 7.3e-13 PFAM
Pfam:7tm_1 49 311 8.4e-61 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAAR9 is a member of a large family of rhodopsin G protein-coupled receptors (GPCRs, or GPRs). GPCRs contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins.[supplied by OMIM, Jul 2005]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Elavl1 A G 8: 4,289,851 W244R probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Fam20c T G 5: 138,755,676 L14R probably damaging Het
Glt1d1 G T 5: 127,689,871 R217L probably benign Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Zc3h13 A G 14: 75,327,601 D718G unknown Het
Other mutations in Taar9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Taar9 APN 10 24109531 missense probably benign
IGL02011:Taar9 APN 10 24108579 missense possibly damaging 0.93
IGL02883:Taar9 APN 10 24109480 missense probably benign 0.08
R1468:Taar9 UTSW 10 24109484 missense possibly damaging 0.47
R1468:Taar9 UTSW 10 24109484 missense possibly damaging 0.47
R1598:Taar9 UTSW 10 24109407 missense possibly damaging 0.90
R2072:Taar9 UTSW 10 24108979 missense probably damaging 1.00
R2471:Taar9 UTSW 10 24109391 missense probably benign 0.00
R2519:Taar9 UTSW 10 24109254 missense probably damaging 1.00
R4793:Taar9 UTSW 10 24109510 missense probably benign
R4801:Taar9 UTSW 10 24108843 missense probably damaging 0.97
R4802:Taar9 UTSW 10 24108843 missense probably damaging 0.97
R5457:Taar9 UTSW 10 24109105 missense probably damaging 0.98
R6450:Taar9 UTSW 10 24109240 missense probably damaging 1.00
R6601:Taar9 UTSW 10 24109047 missense probably damaging 1.00
R6915:Taar9 UTSW 10 24109012 missense possibly damaging 0.53
R7179:Taar9 UTSW 10 24108984 missense probably damaging 1.00
R7480:Taar9 UTSW 10 24108945 missense possibly damaging 0.61
R8200:Taar9 UTSW 10 24109419 missense probably damaging 0.99
Z1088:Taar9 UTSW 10 24108965 missense probably damaging 1.00
Z1177:Taar9 UTSW 10 24109141 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCAGCCCTAAAATGTACAGGC -3'
(R):5'- ATGGCTGCATTTCTCGTGTC -3'

Sequencing Primer
(F):5'- TGAACCTAAGATCTCCTGCTGGG -3'
(R):5'- GTCCTGGCTGCCATACATTATTGATG -3'
Posted On2015-06-10