Incidental Mutation 'R4205:Maml1'
ID318877
Institutional Source Beutler Lab
Gene Symbol Maml1
Ensembl Gene ENSMUSG00000050567
Gene Namemastermind like transcriptional coactivator 1
SynonymsD930008C07Rik, Mam-1
MMRRC Submission 041034-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4205 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50255634-50292311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50257913 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1000 (L1000Q)
Ref Sequence ENSEMBL: ENSMUSP00000059210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059458]
Predicted Effect probably damaging
Transcript: ENSMUST00000059458
AA Change: L1000Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059210
Gene: ENSMUSG00000050567
AA Change: L1000Q

DomainStartEndE-ValueType
MamL-1 14 73 1.04e-32 SMART
low complexity region 77 102 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 419 435 N/A INTRINSIC
low complexity region 588 600 N/A INTRINSIC
coiled coil region 627 671 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135868
SMART Domains Protein: ENSMUSP00000118188
Gene: ENSMUSG00000050567

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
low complexity region 334 350 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
coiled coil region 541 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222498
Meta Mutation Damage Score 0.1964 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is the human homolog of mastermind, a Drosophila protein that plays a role in the Notch signaling pathway involved in cell-fate determination. There is in vitro evidence that the human homolog forms a complex with the intracellular portion of human Notch receptors and can increase expression of a Notch-induced gene. This evidence supports its proposed function as a transcriptional co-activator in the Notch signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality, reduced size, and skeletal muscle degeneration and necrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Elavl1 A G 8: 4,289,851 W244R probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Fam20c T G 5: 138,755,676 L14R probably damaging Het
Glt1d1 G T 5: 127,689,871 R217L probably benign Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Taar9 C T 10: 24,108,579 R319H possibly damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Zc3h13 A G 14: 75,327,601 D718G unknown Het
Other mutations in Maml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Maml1 APN 11 50258714 missense probably damaging 0.97
IGL01326:Maml1 APN 11 50265888 missense probably benign 0.30
IGL01469:Maml1 APN 11 50266526 missense probably damaging 1.00
IGL02336:Maml1 APN 11 50258165 missense probably benign 0.00
IGL02690:Maml1 APN 11 50258630 missense probably damaging 1.00
R0674:Maml1 UTSW 11 50258058 missense probably benign 0.28
R1497:Maml1 UTSW 11 50265707 missense possibly damaging 0.51
R1641:Maml1 UTSW 11 50266947 missense probably benign 0.16
R1888:Maml1 UTSW 11 50266641 missense probably benign 0.00
R1888:Maml1 UTSW 11 50266641 missense probably benign 0.00
R1899:Maml1 UTSW 11 50266130 missense probably damaging 1.00
R2496:Maml1 UTSW 11 50258544 missense probably benign
R3913:Maml1 UTSW 11 50263432 missense probably benign 0.00
R4018:Maml1 UTSW 11 50265784 missense probably damaging 1.00
R4091:Maml1 UTSW 11 50291829 missense probably benign 0.00
R4202:Maml1 UTSW 11 50257913 missense probably damaging 1.00
R4716:Maml1 UTSW 11 50257867 missense probably benign 0.01
R4816:Maml1 UTSW 11 50258335 missense possibly damaging 0.68
R5338:Maml1 UTSW 11 50266951 missense probably benign 0.11
R5460:Maml1 UTSW 11 50266353 missense probably benign 0.36
R6701:Maml1 UTSW 11 50266682 missense probably damaging 1.00
R7336:Maml1 UTSW 11 50266449 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGGACCATCAGAGACTGACC -3'
(R):5'- TGCCTGGCTTAAGTCCTTCG -3'

Sequencing Primer
(F):5'- CATCAGAGACTGACCAGAGCTG -3'
(R):5'- TTAAGTCCTTCGGGGCCC -3'
Posted On2015-06-10