Incidental Mutation 'R4205:Zc3h13'
ID318882
Institutional Source Beutler Lab
Gene Symbol Zc3h13
Ensembl Gene ENSMUSG00000022000
Gene Namezinc finger CCCH type containing 13
Synonyms4930570G11Rik, 3110050K21Rik, 2600010B19Rik, C87618
MMRRC Submission 041034-MU
Accession Numbers

Genbank: NM_026083

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4205 (G1)
Quality Score185
Status Validated
Chromosome14
Chromosomal Location75284373-75344426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75327601 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 718 (D718G)
Ref Sequence ENSEMBL: ENSMUSP00000153882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]
Predicted Effect unknown
Transcript: ENSMUST00000022577
AA Change: D718G
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000
AA Change: D718G

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000227049
AA Change: D718G
Meta Mutation Damage Score 0.0729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9) 

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Elavl1 A G 8: 4,289,851 W244R probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Fam20c T G 5: 138,755,676 L14R probably damaging Het
Glt1d1 G T 5: 127,689,871 R217L probably benign Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Taar9 C T 10: 24,108,579 R319H possibly damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Other mutations in Zc3h13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Zc3h13 APN 14 75330147 missense probably damaging 0.99
IGL01129:Zc3h13 APN 14 75335999 missense probably damaging 1.00
IGL01599:Zc3h13 APN 14 75309723 missense probably damaging 1.00
IGL01844:Zc3h13 APN 14 75343769 utr 3 prime probably benign
IGL02132:Zc3h13 APN 14 75330347 missense probably benign 0.10
IGL03108:Zc3h13 APN 14 75331766 missense possibly damaging 0.73
IGL03299:Zc3h13 APN 14 75293941 missense probably damaging 1.00
IGL03377:Zc3h13 APN 14 75293976 missense possibly damaging 0.53
B5639:Zc3h13 UTSW 14 75316039 missense probably damaging 1.00
FR4304:Zc3h13 UTSW 14 75323603 small insertion probably benign
FR4304:Zc3h13 UTSW 14 75323610 small insertion probably benign
FR4340:Zc3h13 UTSW 14 75323592 small insertion probably benign
FR4449:Zc3h13 UTSW 14 75323601 nonsense probably null
FR4548:Zc3h13 UTSW 14 75323599 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323592 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323597 small insertion probably benign
FR4589:Zc3h13 UTSW 14 75323598 small insertion probably benign
FR4737:Zc3h13 UTSW 14 75323596 small insertion probably benign
FR4737:Zc3h13 UTSW 14 75323599 small insertion probably benign
PIT4696001:Zc3h13 UTSW 14 75331883 missense probably damaging 1.00
R0103:Zc3h13 UTSW 14 75330468 missense probably damaging 0.98
R0103:Zc3h13 UTSW 14 75330468 missense probably damaging 0.98
R0127:Zc3h13 UTSW 14 75323254 missense unknown
R0374:Zc3h13 UTSW 14 75308965 missense probably damaging 1.00
R0396:Zc3h13 UTSW 14 75323482 missense unknown
R0408:Zc3h13 UTSW 14 75292186 nonsense probably null
R0967:Zc3h13 UTSW 14 75343739 missense possibly damaging 0.54
R1006:Zc3h13 UTSW 14 75330549 missense probably damaging 0.99
R1142:Zc3h13 UTSW 14 75315984 missense probably benign 0.14
R1605:Zc3h13 UTSW 14 75337483 nonsense probably null
R2021:Zc3h13 UTSW 14 75330195 missense probably damaging 0.96
R2270:Zc3h13 UTSW 14 75332147 missense probably benign 0.03
R3508:Zc3h13 UTSW 14 75308940 nonsense probably null
R3745:Zc3h13 UTSW 14 75330661 missense probably benign 0.03
R3954:Zc3h13 UTSW 14 75329738 missense possibly damaging 0.85
R4799:Zc3h13 UTSW 14 75339423 missense probably damaging 1.00
R5042:Zc3h13 UTSW 14 75339396 missense probably damaging 0.98
R5133:Zc3h13 UTSW 14 75336009 missense probably damaging 1.00
R5384:Zc3h13 UTSW 14 75343619 missense probably benign 0.14
R5432:Zc3h13 UTSW 14 75331247 missense probably damaging 1.00
R5611:Zc3h13 UTSW 14 75330908 missense probably benign 0.10
R5687:Zc3h13 UTSW 14 75331960 nonsense probably null
R5726:Zc3h13 UTSW 14 75330829 missense possibly damaging 0.84
R5817:Zc3h13 UTSW 14 75328132 missense probably damaging 0.96
R6087:Zc3h13 UTSW 14 75330709 missense probably damaging 0.96
R6224:Zc3h13 UTSW 14 75337409 missense probably damaging 0.99
R6247:Zc3h13 UTSW 14 75343736 missense probably benign 0.14
R6278:Zc3h13 UTSW 14 75330423 missense probably benign 0.01
R6315:Zc3h13 UTSW 14 75308915 missense probably damaging 1.00
R6490:Zc3h13 UTSW 14 75323558 small deletion probably benign
R6598:Zc3h13 UTSW 14 75332183 missense probably damaging 0.99
R7051:Zc3h13 UTSW 14 75331157 missense probably damaging 1.00
R7054:Zc3h13 UTSW 14 75321787 missense probably benign 0.19
R7135:Zc3h13 UTSW 14 75321721 missense unknown
R7307:Zc3h13 UTSW 14 75330541 missense probably damaging 0.96
R7515:Zc3h13 UTSW 14 75308909 missense unknown
R7680:Zc3h13 UTSW 14 75330515 missense probably damaging 0.99
R8031:Zc3h13 UTSW 14 75330630 missense not run
R8048:Zc3h13 UTSW 14 75324537 missense unknown
R8059:Zc3h13 UTSW 14 75327810 missense unknown
Z1177:Zc3h13 UTSW 14 75328065 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGAGCGTGCAGTACTTGATC -3'
(R):5'- GAACATGAATATCCTCGCGCTTC -3'

Sequencing Primer
(F):5'- CTGAGCGTGCAGTACTTGATCTATAC -3'
(R):5'- GATCATGGTCACGATCTCGCTG -3'
Posted On2015-06-10