Incidental Mutation 'R4205:Bclaf3'
ID318891
Institutional Source Beutler Lab
Gene Symbol Bclaf3
Ensembl Gene ENSMUSG00000044150
Gene NameBclaf1 and Thrap3 family member 3
SynonymsA830080D01Rik, LOC382252
MMRRC Submission 041034-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4205 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location159526688-159593081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 159553833 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 419 (S419T)
Ref Sequence ENSEMBL: ENSMUSP00000108083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057180] [ENSMUST00000112464] [ENSMUST00000131623] [ENSMUST00000144598]
Predicted Effect probably damaging
Transcript: ENSMUST00000057180
AA Change: S419T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051031
Gene: ENSMUSG00000044150
AA Change: S419T

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 2 602 3e-202 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112464
AA Change: S419T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108083
Gene: ENSMUSG00000044150
AA Change: S419T

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 2 666 9.9e-162 PFAM
low complexity region 706 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131623
SMART Domains Protein: ENSMUSP00000116320
Gene: ENSMUSG00000044150

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 2 60 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144598
Meta Mutation Damage Score 0.0958 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Male chimeras hemizygous for either of two different gene trapped alleles of this gene appear normal at E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,610,919 I294T probably benign Het
Alpk2 G A 18: 65,305,211 T1037M possibly damaging Het
Ano7 A G 1: 93,380,478 D77G probably benign Het
Arhgef5 A G 6: 43,273,832 T506A possibly damaging Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdhr1 G T 14: 37,080,504 F667L probably benign Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dmrtc2 C T 7: 24,875,806 Q275* probably null Het
Dsg1b A T 18: 20,408,821 D795V probably damaging Het
Elavl1 A G 8: 4,289,851 W244R probably damaging Het
Emilin1 T C 5: 30,919,899 probably benign Het
Fam20c T G 5: 138,755,676 L14R probably damaging Het
Glt1d1 G T 5: 127,689,871 R217L probably benign Het
Gm13762 A G 2: 88,973,138 V251A probably benign Het
Gm498 G T 7: 143,869,227 V17L probably damaging Het
Klk14 G A 7: 43,694,934 R223H probably benign Het
Lrrc26 G T 2: 25,290,158 C57F probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Map2 A G 1: 66,425,290 Y125C probably damaging Het
Mapk1 T C 16: 17,038,457 probably benign Het
Mocos G A 18: 24,666,191 V161M possibly damaging Het
Pcdhgb5 A G 18: 37,732,663 N504D possibly damaging Het
Pcx G A 19: 4,619,166 V731M possibly damaging Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Ptprh C A 7: 4,597,992 G129W probably damaging Het
Rasal1 T C 5: 120,659,563 V120A probably benign Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rtn4rl1 A T 11: 75,265,983 I414F probably damaging Het
Rtn4rl1 C A 11: 75,265,992 P417T probably damaging Het
Shank3 T C 15: 89,503,318 L230P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Taar9 C T 10: 24,108,579 R319H possibly damaging Het
Tbck T A 3: 132,838,028 I880N probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Zc3h13 A G 14: 75,327,601 D718G unknown Het
Other mutations in Bclaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Bclaf3 APN X 159558361 missense probably benign 0.23
IGL01062:Bclaf3 APN X 159553419 missense probably benign 0.01
IGL02394:Bclaf3 APN X 159555489 missense probably damaging 1.00
IGL02562:Bclaf3 APN X 159566438 missense probably benign 0.02
IGL02861:Bclaf3 APN X 159555528 missense possibly damaging 0.58
R3741:Bclaf3 UTSW X 159551832 missense probably benign 0.00
R3742:Bclaf3 UTSW X 159551832 missense probably benign 0.00
R3788:Bclaf3 UTSW X 159566496 missense probably benign 0.00
R3789:Bclaf3 UTSW X 159566496 missense probably benign 0.00
R4202:Bclaf3 UTSW X 159553833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCTGCAAATAGAGAGTTAGATTG -3'
(R):5'- CCAGGACTTTGGAAGAAATTATTGG -3'

Sequencing Primer
(F):5'- TTGTTTCAGTACTACAAGAGGAAGAG -3'
(R):5'- TGGAAGCTGCAAATTAAGG -3'
Posted On2015-06-10