Incidental Mutation 'R4206:Dst'
ID 318892
Institutional Source Beutler Lab
Gene Symbol Dst
Ensembl Gene ENSMUSG00000026131
Gene Name dystonin
Synonyms BPAG1-n, ah, athetoid, bullous pemphigoid antigen 1, A830042E19Rik, Macf2, nmf339, Bpag1, nmf203, bullous pemphigoid antigen 1, BPAG1, Bpag, 2310001O04Rik
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.227) question?
Stock # R4206 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 33908225-34308661 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34212247 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1801 (R1801H)
Ref Sequence ENSEMBL: ENSMUSP00000141127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097785] [ENSMUST00000097786] [ENSMUST00000115104] [ENSMUST00000183034] [ENSMUST00000185269]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000097785
AA Change: R4141H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095392
Gene: ENSMUSG00000026131
AA Change: R4141H

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.09e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.08e-51 SMART
low complexity region 7224 7242 N/A INTRINSIC
low complexity region 7252 7264 N/A INTRINSIC
low complexity region 7313 7336 N/A INTRINSIC
PDB:3GJO|H 7364 7393 9e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000097786
AA Change: R2127H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095393
Gene: ENSMUSG00000026131
AA Change: R2127H

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 6e-43 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 2e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 2e-62 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
SPEC 1555 1664 2.19e-1 SMART
internal_repeat_6 1757 1797 1.18e-5 PROSPERO
SPEC 1838 1957 1.75e-9 SMART
SPEC 1964 2070 3.7e-8 SMART
SPEC 2077 2176 4.56e-8 SMART
SPEC 2186 2285 3.78e0 SMART
low complexity region 2358 2374 N/A INTRINSIC
SPEC 2433 2538 1.98e-8 SMART
SPEC 2545 2649 3.62e-11 SMART
SPEC 2659 2759 1.65e-5 SMART
SPEC 2766 2868 7.75e-11 SMART
SPEC 2875 2975 2.3e-4 SMART
SPEC 2985 3084 3.01e0 SMART
SPEC 3091 3194 2.74e-2 SMART
SPEC 3201 3305 2.46e-4 SMART
SPEC 3312 3414 1.27e-15 SMART
SPEC 3421 3523 1.54e-14 SMART
SPEC 3530 3632 8.07e-2 SMART
SPEC 3639 3741 3.67e-12 SMART
SPEC 3748 3849 1.97e-12 SMART
SPEC 3856 3962 4.19e-7 SMART
SPEC 3969 4071 2.06e-15 SMART
SPEC 4078 4181 2.89e-10 SMART
SPEC 4188 4290 2.61e-26 SMART
SPEC 4297 4399 5.31e-18 SMART
SPEC 4406 4508 1.25e-14 SMART
SPEC 4515 4618 9.1e-17 SMART
SPEC 4625 4726 9.3e-23 SMART
SPEC 4733 4835 5.43e-15 SMART
SPEC 4845 4975 1.5e-8 SMART
EFh 5009 5037 4.12e-3 SMART
EFh 5045 5073 1.25e-2 SMART
GAS2 5084 5162 3.08e-51 SMART
low complexity region 5210 5228 N/A INTRINSIC
low complexity region 5238 5250 N/A INTRINSIC
low complexity region 5299 5322 N/A INTRINSIC
PDB:3GJO|H 5350 5379 1e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115104
AA Change: R4141H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110756
Gene: ENSMUSG00000026131
AA Change: R4141H

DomainStartEndE-ValueType
CH 37 136 1.62e-28 SMART
CH 153 250 3.72e-19 SMART
PDB:2ODU|A 261 479 1e-42 PDB
low complexity region 520 545 N/A INTRINSIC
SPEC 602 699 8.64e-9 SMART
SPEC 702 802 2.94e-11 SMART
Blast:SPEC 809 973 4e-73 BLAST
coiled coil region 1095 1132 N/A INTRINSIC
Blast:SPEC 1176 1285 6e-63 BLAST
SPEC 1292 1421 4.11e0 SMART
SPEC 1439 1538 4.66e0 SMART
PLEC 1537 1581 9.05e-3 SMART
PLEC 1582 1619 2.7e0 SMART
PLEC 1657 1694 2.23e0 SMART
PLEC 1695 1732 4.25e1 SMART
PLEC 1735 1770 1.39e2 SMART
PLEC 1771 1808 7.4e-8 SMART
PLEC 1811 1846 5.8e-1 SMART
PLEC 1847 1884 2.71e1 SMART
PLEC 1886 1922 4.66e0 SMART
low complexity region 2294 2307 N/A INTRINSIC
low complexity region 2366 2381 N/A INTRINSIC
low complexity region 2477 2491 N/A INTRINSIC
low complexity region 2566 2593 N/A INTRINSIC
low complexity region 2661 2675 N/A INTRINSIC
low complexity region 2793 2799 N/A INTRINSIC
low complexity region 2839 2847 N/A INTRINSIC
low complexity region 3046 3057 N/A INTRINSIC
low complexity region 3294 3314 N/A INTRINSIC
SPEC 3321 3427 5.36e-1 SMART
low complexity region 3515 3527 N/A INTRINSIC
low complexity region 3548 3558 N/A INTRINSIC
SPEC 3569 3678 2.19e-1 SMART
internal_repeat_7 3771 3811 5.08e-5 PROSPERO
SPEC 3852 3971 1.75e-9 SMART
SPEC 3978 4084 3.7e-8 SMART
SPEC 4091 4190 4.56e-8 SMART
SPEC 4200 4299 3.78e0 SMART
low complexity region 4372 4388 N/A INTRINSIC
SPEC 4447 4552 1.98e-8 SMART
SPEC 4559 4663 3.62e-11 SMART
SPEC 4673 4773 1.65e-5 SMART
SPEC 4780 4882 7.75e-11 SMART
SPEC 4889 4989 2.3e-4 SMART
SPEC 4999 5098 3.01e0 SMART
SPEC 5105 5208 2.74e-2 SMART
SPEC 5215 5319 2.46e-4 SMART
SPEC 5326 5428 1.27e-15 SMART
SPEC 5435 5537 1.54e-14 SMART
SPEC 5544 5646 8.07e-2 SMART
SPEC 5653 5755 3.67e-12 SMART
SPEC 5762 5863 1.97e-12 SMART
SPEC 5870 5976 4.19e-7 SMART
SPEC 5983 6085 2.06e-15 SMART
SPEC 6092 6195 2.89e-10 SMART
SPEC 6202 6304 2.61e-26 SMART
SPEC 6311 6413 5.31e-18 SMART
SPEC 6420 6522 1.25e-14 SMART
SPEC 6529 6632 9.1e-17 SMART
SPEC 6639 6740 9.3e-23 SMART
SPEC 6747 6849 5.43e-15 SMART
SPEC 6859 6989 1.5e-8 SMART
EFh 7023 7051 4.12e-3 SMART
EFh 7059 7087 1.25e-2 SMART
GAS2 7098 7176 3.85e-52 SMART
low complexity region 7200 7218 N/A INTRINSIC
low complexity region 7228 7240 N/A INTRINSIC
low complexity region 7326 7349 N/A INTRINSIC
PDB:3GJO|H 7377 7406 9e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000183034
AA Change: R4319H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138308
Gene: ENSMUSG00000026131
AA Change: R4319H

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
CH 215 314 1.62e-28 SMART
CH 331 428 3.72e-19 SMART
PDB:2ODU|A 439 657 1e-42 PDB
low complexity region 698 723 N/A INTRINSIC
SPEC 780 877 8.64e-9 SMART
SPEC 880 980 2.94e-11 SMART
Blast:SPEC 987 1151 5e-73 BLAST
coiled coil region 1273 1310 N/A INTRINSIC
Blast:SPEC 1354 1463 8e-63 BLAST
SPEC 1470 1599 4.11e0 SMART
SPEC 1617 1716 4.66e0 SMART
PLEC 1715 1759 9.05e-3 SMART
PLEC 1760 1797 2.7e0 SMART
PLEC 1835 1872 2.23e0 SMART
PLEC 1873 1910 4.25e1 SMART
PLEC 1913 1948 1.39e2 SMART
PLEC 1949 1986 7.4e-8 SMART
PLEC 1989 2024 5.8e-1 SMART
PLEC 2025 2062 2.71e1 SMART
PLEC 2064 2100 4.66e0 SMART
low complexity region 2472 2485 N/A INTRINSIC
low complexity region 2544 2559 N/A INTRINSIC
low complexity region 2655 2669 N/A INTRINSIC
low complexity region 2744 2771 N/A INTRINSIC
low complexity region 2839 2853 N/A INTRINSIC
low complexity region 2971 2977 N/A INTRINSIC
low complexity region 3017 3025 N/A INTRINSIC
low complexity region 3224 3235 N/A INTRINSIC
low complexity region 3472 3492 N/A INTRINSIC
SPEC 3499 3605 5.36e-1 SMART
low complexity region 3693 3705 N/A INTRINSIC
low complexity region 3726 3736 N/A INTRINSIC
SPEC 3747 3856 2.19e-1 SMART
internal_repeat_12 3949 3989 5.99e-5 PROSPERO
SPEC 4030 4149 1.75e-9 SMART
SPEC 4156 4262 3.7e-8 SMART
SPEC 4269 4368 4.56e-8 SMART
SPEC 4378 4477 3.78e0 SMART
low complexity region 4550 4566 N/A INTRINSIC
SPEC 4625 4730 1.98e-8 SMART
SPEC 4737 4841 3.62e-11 SMART
SPEC 4851 4951 1.65e-5 SMART
SPEC 4958 5060 7.75e-11 SMART
SPEC 5067 5167 2.3e-4 SMART
SPEC 5177 5276 3.01e0 SMART
SPEC 5283 5386 2.74e-2 SMART
SPEC 5393 5497 2.46e-4 SMART
SPEC 5504 5606 1.27e-15 SMART
SPEC 5613 5715 1.69e-11 SMART
SPEC 5722 5824 9.33e-5 SMART
SPEC 5831 5933 8.07e-2 SMART
SPEC 5940 6042 3.67e-12 SMART
SPEC 6049 6150 1.97e-12 SMART
SPEC 6157 6263 4.19e-7 SMART
SPEC 6270 6372 2.06e-15 SMART
SPEC 6379 6482 2.89e-10 SMART
SPEC 6489 6591 2.61e-26 SMART
SPEC 6598 6700 5.31e-18 SMART
SPEC 6707 6809 1.25e-14 SMART
SPEC 6816 6919 9.1e-17 SMART
SPEC 6926 7027 9.3e-23 SMART
SPEC 7034 7136 5.43e-15 SMART
SPEC 7146 7276 1.5e-8 SMART
EFh 7310 7338 4.12e-3 SMART
EFh 7346 7374 1.25e-2 SMART
GAS2 7385 7463 3.08e-51 SMART
low complexity region 7511 7529 N/A INTRINSIC
low complexity region 7539 7551 N/A INTRINSIC
low complexity region 7637 7660 N/A INTRINSIC
PDB:3GJO|H 7688 7717 9e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000185269
AA Change: R1801H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141127
Gene: ENSMUSG00000026131
AA Change: R1801H

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
PDB:2ODU|A 56 153 6e-8 PDB
low complexity region 194 219 N/A INTRINSIC
SPEC 276 373 5.4e-11 SMART
SPEC 376 476 1.8e-13 SMART
Blast:SPEC 483 647 1e-73 BLAST
coiled coil region 769 806 N/A INTRINSIC
Blast:SPEC 850 959 1e-62 BLAST
SPEC 966 1095 2.6e-2 SMART
SPEC 1113 1212 2.9e-2 SMART
SPEC 1229 1338 1.4e-3 SMART
internal_repeat_10 1431 1471 9.93e-6 PROSPERO
SPEC 1512 1631 1.1e-11 SMART
SPEC 1638 1744 2.3e-10 SMART
SPEC 1751 1850 2.9e-10 SMART
SPEC 1860 1959 2.4e-2 SMART
low complexity region 2032 2048 N/A INTRINSIC
SPEC 2107 2212 1.2e-10 SMART
SPEC 2219 2323 2.3e-13 SMART
SPEC 2333 2433 1.1e-7 SMART
SPEC 2440 2542 5e-13 SMART
SPEC 2549 2649 1.4e-6 SMART
SPEC 2659 2758 1.9e-2 SMART
SPEC 2765 2868 1.8e-4 SMART
SPEC 2875 2979 1.5e-6 SMART
SPEC 2986 3088 8.2e-18 SMART
SPEC 3095 3197 1.1e-13 SMART
SPEC 3204 3306 6e-7 SMART
SPEC 3313 3415 5.1e-4 SMART
SPEC 3422 3524 2.3e-14 SMART
SPEC 3531 3632 1.3e-14 SMART
SPEC 3639 3745 2.6e-9 SMART
SPEC 3752 3854 1.3e-17 SMART
SPEC 3861 3964 1.8e-12 SMART
SPEC 3971 4073 1.6e-28 SMART
SPEC 4080 4182 3.3e-20 SMART
SPEC 4189 4291 7.6e-17 SMART
SPEC 4298 4401 5.6e-19 SMART
SPEC 4408 4509 5.9e-25 SMART
SPEC 4516 4618 3.4e-17 SMART
SPEC 4628 4758 9.7e-11 SMART
EFh 4792 4820 2e-5 SMART
EFh 4828 4856 6e-5 SMART
GAS2 4867 4945 9.8e-56 SMART
low complexity region 4969 4987 N/A INTRINSIC
low complexity region 4997 5009 N/A INTRINSIC
low complexity region 5095 5118 N/A INTRINSIC
PDB:3GJO|H 5146 5175 3e-9 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene produce peripheral nervous system demyelination resulting in impaired muscle function and shorter lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,473,515 K81R probably benign Het
Acacb T C 5: 114,213,651 F1150L probably benign Het
Acat3 A G 17: 12,927,386 Y237H possibly damaging Het
Arfgap3 T C 15: 83,322,668 T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cabin1 T C 10: 75,754,841 S23G possibly damaging Het
Clasp1 A G 1: 118,578,906 N949S probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dgka A T 10: 128,721,195 L637Q probably damaging Het
Edil3 T C 13: 89,180,278 S284P probably damaging Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Ell2 A G 13: 75,761,948 D139G probably damaging Het
Fam187a A G 11: 102,886,212 R281G probably damaging Het
Gin1 A G 1: 97,792,420 D380G possibly damaging Het
Gpr149 T G 3: 62,604,503 D25A possibly damaging Het
Gyg A G 3: 20,152,737 S90P probably benign Het
Hpx C T 7: 105,595,147 M190I probably null Het
Irf2bpl C T 12: 86,883,036 V288I probably benign Het
Lyst A G 13: 13,635,989 H748R probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mpdz A T 4: 81,381,762 M333K probably benign Het
Muc5ac C T 7: 141,817,110 S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntsr1 A G 2: 180,500,752 D112G probably damaging Het
Olfr1410 A C 1: 92,608,595 T253P possibly damaging Het
Olfr657 T A 7: 104,636,149 N158K possibly damaging Het
Olfr8 T C 10: 78,955,283 F26S probably benign Het
Parg A G 14: 32,254,536 K178R probably benign Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pld1 G A 3: 28,120,783 V857I probably benign Het
Rad54l2 A C 9: 106,717,795 V321G probably damaging Het
Rcn2 A G 9: 56,045,207 Y112C possibly damaging Het
Rnf123 A T 9: 108,063,963 D639E probably benign Het
Rufy2 C T 10: 63,004,772 Q441* probably null Het
Scgb2b12 T C 7: 32,326,638 Y43C probably damaging Het
Scrn3 T A 2: 73,319,501 probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc22a8 T C 19: 8,608,233 S321P probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tex2 A G 11: 106,567,572 probably benign Het
Tmem2 G T 19: 21,842,115 R1090L probably damaging Het
Trip13 A G 13: 73,932,890 I119T probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Ttn A G 2: 76,772,567 I16691T possibly damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 V142A probably damaging Het
Uggt2 C T 14: 119,049,262 D221N probably damaging Het
Wnt4 A G 4: 137,296,343 K207R possibly damaging Het
Zfp608 T C 18: 54,988,195 R107G probably damaging Het
Other mutations in Dst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Dst APN 1 34251839 missense probably damaging 1.00
IGL00309:Dst APN 1 34160652 missense probably damaging 1.00
IGL00334:Dst APN 1 34166292 missense probably damaging 1.00
IGL00470:Dst APN 1 34188962 missense probably damaging 1.00
IGL00481:Dst APN 1 34169329 splice site probably benign
IGL00499:Dst APN 1 34290423 missense probably damaging 0.99
IGL00803:Dst APN 1 34164124 missense possibly damaging 0.89
IGL00850:Dst APN 1 34306624 missense probably damaging 1.00
IGL00957:Dst APN 1 34228407 missense probably benign 0.27
IGL00975:Dst APN 1 34188312 missense possibly damaging 0.86
IGL00984:Dst APN 1 34256320 missense probably damaging 1.00
IGL01284:Dst APN 1 34163928 missense probably damaging 1.00
IGL01393:Dst APN 1 34167625 missense possibly damaging 0.91
IGL01397:Dst APN 1 34257744 missense probably damaging 1.00
IGL01399:Dst APN 1 34117517 missense probably benign 0.41
IGL01412:Dst APN 1 34242620 missense probably benign 0.21
IGL01527:Dst APN 1 34247653 missense probably damaging 1.00
IGL01537:Dst APN 1 34275320 missense probably damaging 1.00
IGL01618:Dst APN 1 34188909 nonsense probably null
IGL01636:Dst APN 1 34215569 missense probably damaging 1.00
IGL01642:Dst APN 1 34189389 missense probably damaging 1.00
IGL01672:Dst APN 1 34225693 missense probably damaging 1.00
IGL01685:Dst APN 1 34170452 missense probably damaging 0.99
IGL01694:Dst APN 1 34188160 missense probably benign 0.13
IGL01777:Dst APN 1 34199397 missense probably benign 0.07
IGL01800:Dst APN 1 34262092 missense probably damaging 1.00
IGL01811:Dst APN 1 34164092 missense probably damaging 1.00
IGL01960:Dst APN 1 34290489 missense probably damaging 1.00
IGL02031:Dst APN 1 34189917 missense possibly damaging 0.95
IGL02103:Dst APN 1 34190118 missense possibly damaging 0.90
IGL02121:Dst APN 1 34228657 missense probably damaging 1.00
IGL02315:Dst APN 1 34198665 missense probably damaging 1.00
IGL02317:Dst APN 1 34295163 missense probably damaging 1.00
IGL02469:Dst APN 1 34188828 missense probably damaging 1.00
IGL02492:Dst APN 1 34152193 splice site probably benign
IGL02510:Dst APN 1 34229251 splice site probably null
IGL02522:Dst APN 1 34250700 splice site probably benign
IGL02540:Dst APN 1 34135204 missense probably damaging 1.00
IGL02588:Dst APN 1 34117484 missense probably damaging 1.00
IGL02676:Dst APN 1 34307587 missense probably damaging 1.00
IGL02688:Dst APN 1 34195952 missense probably damaging 1.00
IGL02700:Dst APN 1 34262120 missense probably damaging 1.00
IGL02794:Dst APN 1 34270829 missense probably damaging 1.00
IGL02823:Dst APN 1 34192083 missense possibly damaging 0.83
IGL02935:Dst APN 1 34186845 nonsense probably null
IGL02940:Dst APN 1 34289587 missense probably benign 0.36
IGL02994:Dst APN 1 34229252 splice site probably benign
IGL02996:Dst APN 1 34188398 missense possibly damaging 0.93
IGL02998:Dst APN 1 34268275 missense probably damaging 1.00
IGL03027:Dst APN 1 34186025 missense possibly damaging 0.51
IGL03033:Dst APN 1 34169745 splice site probably benign
IGL03099:Dst APN 1 34275781 missense probably damaging 1.00
IGL03119:Dst APN 1 34161062 missense probably damaging 1.00
IGL03121:Dst APN 1 34217803 splice site probably benign
IGL03132:Dst APN 1 34256641 missense probably benign 0.06
IGL03220:Dst APN 1 34185995 missense probably damaging 0.99
IGL03230:Dst APN 1 34184052 nonsense probably null
IGL03245:Dst APN 1 34211148 splice site probably null
IGL03380:Dst APN 1 34257800 missense probably damaging 1.00
Doodle UTSW 1 34208558 nonsense probably null
dyssed UTSW 1 34256353 critical splice donor site probably null
gobble UTSW 1 34165155 critical splice donor site probably null
Phelps UTSW 1 34223795 splice site probably null
tinsel UTSW 1 34164167 missense probably damaging 1.00
Wastable UTSW 1 34295289 missense probably damaging 1.00
E0370:Dst UTSW 1 34249471 splice site probably benign
FR4304:Dst UTSW 1 34200964 missense probably damaging 0.99
G1citation:Dst UTSW 1 34275674 missense probably damaging 0.99
IGL02799:Dst UTSW 1 34179849 missense possibly damaging 0.92
R0006:Dst UTSW 1 34228918 missense probably benign 0.30
R0006:Dst UTSW 1 34228918 missense probably benign 0.30
R0023:Dst UTSW 1 34189119 missense probably damaging 1.00
R0023:Dst UTSW 1 34189119 missense probably damaging 1.00
R0024:Dst UTSW 1 34189119 missense probably damaging 1.00
R0027:Dst UTSW 1 34189119 missense probably damaging 1.00
R0049:Dst UTSW 1 34275781 missense probably damaging 1.00
R0053:Dst UTSW 1 34294550 splice site probably null
R0053:Dst UTSW 1 34294550 splice site probably null
R0058:Dst UTSW 1 34006224 missense possibly damaging 0.93
R0066:Dst UTSW 1 34189553 missense possibly damaging 0.67
R0066:Dst UTSW 1 34189553 missense possibly damaging 0.67
R0085:Dst UTSW 1 34229187 missense probably damaging 1.00
R0125:Dst UTSW 1 34270903 missense probably damaging 1.00
R0152:Dst UTSW 1 34189119 missense probably damaging 1.00
R0165:Dst UTSW 1 34154646 splice site probably benign
R0172:Dst UTSW 1 34270854 missense probably damaging 1.00
R0207:Dst UTSW 1 34186935 missense probably benign 0.02
R0219:Dst UTSW 1 34303478 missense probably damaging 0.99
R0349:Dst UTSW 1 34199553 missense probably benign 0.12
R0386:Dst UTSW 1 34217836 missense probably damaging 1.00
R0389:Dst UTSW 1 34294550 splice site probably null
R0395:Dst UTSW 1 34189119 missense probably damaging 1.00
R0423:Dst UTSW 1 34278035 missense possibly damaging 0.95
R0443:Dst UTSW 1 34294550 splice site probably null
R0472:Dst UTSW 1 34266960 critical splice donor site probably null
R0490:Dst UTSW 1 34307368 nonsense probably null
R0513:Dst UTSW 1 34219531 splice site probably benign
R0539:Dst UTSW 1 34189119 missense probably damaging 1.00
R0562:Dst UTSW 1 34227981 missense probably damaging 1.00
R0569:Dst UTSW 1 34293427 missense probably damaging 1.00
R0600:Dst UTSW 1 34189119 missense probably damaging 1.00
R0608:Dst UTSW 1 34290356 splice site probably null
R0609:Dst UTSW 1 34266960 critical splice donor site probably null
R0630:Dst UTSW 1 34193450 missense probably benign 0.05
R0630:Dst UTSW 1 34199473 missense probably damaging 0.98
R0632:Dst UTSW 1 34271413 missense probably damaging 1.00
R0713:Dst UTSW 1 34189119 missense probably damaging 1.00
R0724:Dst UTSW 1 34188677 missense probably benign 0.00
R0761:Dst UTSW 1 34182767 missense probably benign 0.33
R0801:Dst UTSW 1 34170389 missense probably damaging 0.99
R0829:Dst UTSW 1 34163220 missense probably damaging 1.00
R0939:Dst UTSW 1 34244383 missense probably damaging 1.00
R0945:Dst UTSW 1 34271419 missense probably damaging 1.00
R0992:Dst UTSW 1 34199536 missense probably damaging 0.97
R1018:Dst UTSW 1 34194093 missense probably damaging 1.00
R1077:Dst UTSW 1 34164167 missense probably damaging 1.00
R1079:Dst UTSW 1 34186863 missense possibly damaging 0.86
R1127:Dst UTSW 1 34275277 missense probably damaging 1.00
R1129:Dst UTSW 1 34199554 missense probably benign 0.28
R1141:Dst UTSW 1 34188696 missense possibly damaging 0.85
R1167:Dst UTSW 1 34223858 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1195:Dst UTSW 1 34211154 missense probably damaging 1.00
R1333:Dst UTSW 1 34228347 missense probably damaging 1.00
R1352:Dst UTSW 1 34229248 critical splice donor site probably null
R1365:Dst UTSW 1 34188194 missense probably benign 0.02
R1382:Dst UTSW 1 34268833 missense probably damaging 0.99
R1389:Dst UTSW 1 34211232 missense probably damaging 1.00
R1394:Dst UTSW 1 34165155 critical splice donor site probably null
R1395:Dst UTSW 1 34165155 critical splice donor site probably null
R1435:Dst UTSW 1 34113945 missense probably damaging 1.00
R1450:Dst UTSW 1 34188395 missense probably damaging 1.00
R1450:Dst UTSW 1 34212259 missense probably damaging 0.99
R1453:Dst UTSW 1 34189446 missense possibly damaging 0.85
R1479:Dst UTSW 1 34264515 splice site probably null
R1483:Dst UTSW 1 34252998 missense probably damaging 1.00
R1491:Dst UTSW 1 34154594 missense probably damaging 0.99
R1536:Dst UTSW 1 34260372 splice site probably benign
R1551:Dst UTSW 1 34192212 missense probably benign 0.01
R1573:Dst UTSW 1 34201231 missense probably damaging 1.00
R1614:Dst UTSW 1 34275263 missense probably damaging 1.00
R1615:Dst UTSW 1 34199371 missense probably damaging 1.00
R1645:Dst UTSW 1 34225722 missense probably damaging 1.00
R1655:Dst UTSW 1 34282576 nonsense probably null
R1663:Dst UTSW 1 34163385 missense probably damaging 1.00
R1674:Dst UTSW 1 34223795 splice site probably null
R1702:Dst UTSW 1 34167340 missense probably damaging 1.00
R1707:Dst UTSW 1 34167646 missense probably damaging 1.00
R1747:Dst UTSW 1 34160709 missense probably damaging 1.00
R1760:Dst UTSW 1 34228603 missense probably damaging 1.00
R1773:Dst UTSW 1 34291899 missense probably damaging 0.99
R1793:Dst UTSW 1 34152471 nonsense probably null
R1842:Dst UTSW 1 34164119 missense probably null 0.98
R1869:Dst UTSW 1 34252832 missense probably damaging 0.99
R1879:Dst UTSW 1 34188843 missense probably benign 0.15
R1883:Dst UTSW 1 34189308 missense possibly damaging 0.74
R1912:Dst UTSW 1 34291850 missense probably damaging 1.00
R1920:Dst UTSW 1 34161029 missense probably damaging 0.99
R1921:Dst UTSW 1 34161029 missense probably damaging 0.99
R1943:Dst UTSW 1 34228369 missense possibly damaging 0.67
R1958:Dst UTSW 1 34163721 missense probably damaging 1.00
R1962:Dst UTSW 1 34191016 missense possibly damaging 0.47
R1991:Dst UTSW 1 34190258 missense probably benign 0.11
R1998:Dst UTSW 1 34256347 missense probably damaging 1.00
R2001:Dst UTSW 1 34184063 missense probably damaging 0.97
R2007:Dst UTSW 1 34226012 splice site probably benign
R2021:Dst UTSW 1 34166291 missense possibly damaging 0.70
R2022:Dst UTSW 1 34166291 missense possibly damaging 0.70
R2035:Dst UTSW 1 34271413 missense probably damaging 1.00
R2077:Dst UTSW 1 34211170 missense probably damaging 1.00
R2103:Dst UTSW 1 34190258 missense probably benign 0.11
R2111:Dst UTSW 1 34169178 missense probably damaging 1.00
R2112:Dst UTSW 1 34169178 missense probably damaging 1.00
R2113:Dst UTSW 1 34275236 missense probably damaging 0.97
R2201:Dst UTSW 1 34195921 missense possibly damaging 0.60
R2214:Dst UTSW 1 34271401 missense probably damaging 1.00
R2219:Dst UTSW 1 34170433 missense probably damaging 1.00
R2233:Dst UTSW 1 34274262 missense probably damaging 1.00
R2267:Dst UTSW 1 34295466 missense probably damaging 1.00
R2290:Dst UTSW 1 34229200 missense probably damaging 1.00
R2323:Dst UTSW 1 34228437 missense possibly damaging 0.93
R2424:Dst UTSW 1 34167060 missense probably damaging 1.00
R2426:Dst UTSW 1 34192812 missense probably benign 0.03
R2495:Dst UTSW 1 34199373 missense probably damaging 0.99
R2507:Dst UTSW 1 34011909 missense probably damaging 0.98
R2507:Dst UTSW 1 34188417 missense possibly damaging 0.85
R2510:Dst UTSW 1 34212286 missense probably benign
R2831:Dst UTSW 1 34275292 missense probably damaging 1.00
R2929:Dst UTSW 1 34167062 nonsense probably null
R3033:Dst UTSW 1 34152285 missense probably damaging 0.99
R3121:Dst UTSW 1 34289648 missense probably damaging 1.00
R3424:Dst UTSW 1 34198505 splice site probably benign
R3437:Dst UTSW 1 34190222 missense probably damaging 1.00
R3699:Dst UTSW 1 34213074 splice site probably benign
R3739:Dst UTSW 1 34268894 splice site probably benign
R3796:Dst UTSW 1 34181915 missense probably benign 0.15
R3847:Dst UTSW 1 34212319 missense probably damaging 1.00
R3848:Dst UTSW 1 34212319 missense probably damaging 1.00
R3849:Dst UTSW 1 34212319 missense probably damaging 1.00
R3850:Dst UTSW 1 34189274 nonsense probably null
R3850:Dst UTSW 1 34212319 missense probably damaging 1.00
R3873:Dst UTSW 1 34289620 missense probably damaging 1.00
R3875:Dst UTSW 1 34171247 missense probably damaging 1.00
R3973:Dst UTSW 1 34011898 missense probably benign 0.34
R4014:Dst UTSW 1 34191282 nonsense probably null
R4043:Dst UTSW 1 34190684 missense probably benign 0.03
R4057:Dst UTSW 1 34186054 splice site probably benign
R4074:Dst UTSW 1 34192269 missense probably benign 0.20
R4074:Dst UTSW 1 34228461 missense probably damaging 0.97
R4075:Dst UTSW 1 34192269 missense probably benign 0.20
R4076:Dst UTSW 1 34192269 missense probably benign 0.20
R4230:Dst UTSW 1 34195828 missense probably benign 0.04
R4242:Dst UTSW 1 34006216 missense possibly damaging 0.88
R4273:Dst UTSW 1 34192340 missense possibly damaging 0.72
R4366:Dst UTSW 1 34251878 missense probably damaging 1.00
R4370:Dst UTSW 1 34251728 frame shift probably null
R4379:Dst UTSW 1 34163235 missense probably damaging 1.00
R4379:Dst UTSW 1 34227975 missense probably benign 0.07
R4380:Dst UTSW 1 34163235 missense probably damaging 1.00
R4381:Dst UTSW 1 34163235 missense probably damaging 1.00
R4423:Dst UTSW 1 34188393 missense possibly damaging 0.76
R4427:Dst UTSW 1 34181460 missense probably benign 0.19
R4456:Dst UTSW 1 34190719 missense probably benign 0.06
R4469:Dst UTSW 1 34191842 missense probably benign 0.02
R4502:Dst UTSW 1 34247691 missense probably damaging 0.99
R4503:Dst UTSW 1 34262253 critical splice donor site probably null
R4545:Dst UTSW 1 34188738 missense probably damaging 0.99
R4610:Dst UTSW 1 34169856 missense probably damaging 1.00
R4633:Dst UTSW 1 34170434 missense probably damaging 1.00
R4675:Dst UTSW 1 34275703 missense possibly damaging 0.94
R4687:Dst UTSW 1 34201123 missense probably damaging 1.00
R4739:Dst UTSW 1 34191147 missense probably benign 0.01
R4751:Dst UTSW 1 34191884 missense probably benign 0.21
R4754:Dst UTSW 1 34212309 missense probably damaging 1.00
R4771:Dst UTSW 1 34249484 missense probably damaging 1.00
R4819:Dst UTSW 1 33968835 missense probably benign 0.03
R4830:Dst UTSW 1 34198505 splice site probably null
R4839:Dst UTSW 1 34190862 missense probably damaging 0.96
R4845:Dst UTSW 1 34193127 missense probably benign 0.02
R4904:Dst UTSW 1 34169798 missense probably damaging 0.99
R4932:Dst UTSW 1 34228683 missense possibly damaging 0.47
R4934:Dst UTSW 1 34208588 missense probably damaging 1.00
R4952:Dst UTSW 1 34271422 missense probably damaging 1.00
R4961:Dst UTSW 1 33968823 missense possibly damaging 0.53
R4976:Dst UTSW 1 34195969 nonsense probably null
R4980:Dst UTSW 1 34256288 missense probably damaging 1.00
R5011:Dst UTSW 1 34250647 missense probably damaging 1.00
R5013:Dst UTSW 1 34250647 missense probably damaging 1.00
R5059:Dst UTSW 1 34163346 missense possibly damaging 0.70
R5074:Dst UTSW 1 34295263 missense probably damaging 1.00
R5114:Dst UTSW 1 34202559 missense probably damaging 0.98
R5119:Dst UTSW 1 34195969 nonsense probably null
R5182:Dst UTSW 1 34179086 missense probably benign
R5236:Dst UTSW 1 34164417 missense probably damaging 1.00
R5240:Dst UTSW 1 34208558 nonsense probably null
R5254:Dst UTSW 1 34177931 nonsense probably null
R5275:Dst UTSW 1 34180148 missense probably benign 0.13
R5281:Dst UTSW 1 34257782 missense probably benign 0.29
R5299:Dst UTSW 1 34135092 missense probably damaging 1.00
R5316:Dst UTSW 1 34223848 missense probably damaging 0.97
R5319:Dst UTSW 1 34225977 missense possibly damaging 0.95
R5425:Dst UTSW 1 34179750 missense probably benign 0.00
R5443:Dst UTSW 1 34228539 missense probably damaging 1.00
R5522:Dst UTSW 1 34257873 missense possibly damaging 0.46
R5537:Dst UTSW 1 34189878 missense probably benign 0.25
R5548:Dst UTSW 1 34189328 missense probably benign
R5557:Dst UTSW 1 34282586 missense probably damaging 1.00
R5597:Dst UTSW 1 34192713 missense probably benign 0.07
R5623:Dst UTSW 1 34190133 missense possibly damaging 0.56
R5630:Dst UTSW 1 34188785 frame shift probably null
R5660:Dst UTSW 1 34282493 missense probably damaging 1.00
R5730:Dst UTSW 1 34117526 splice site probably null
R5762:Dst UTSW 1 34179357 missense probably damaging 0.99
R5810:Dst UTSW 1 34183040 intron probably benign
R5816:Dst UTSW 1 34179234 missense probably benign
R5846:Dst UTSW 1 34195861 nonsense probably null
R5874:Dst UTSW 1 34179589 missense probably damaging 0.98
R5899:Dst UTSW 1 34295289 missense probably damaging 1.00
R5923:Dst UTSW 1 34181759 missense probably benign 0.00
R5936:Dst UTSW 1 34307458 missense probably damaging 1.00
R5946:Dst UTSW 1 34174192 missense probably benign 0.01
R5950:Dst UTSW 1 34262060 missense probably damaging 1.00
R5958:Dst UTSW 1 34186050 missense probably damaging 0.97
R5973:Dst UTSW 1 34156857 missense probably damaging 1.00
R5979:Dst UTSW 1 34160372 intron probably benign
R5980:Dst UTSW 1 34182891 missense probably benign 0.34
R5984:Dst UTSW 1 34172263 missense probably benign 0.05
R6000:Dst UTSW 1 34212223 missense possibly damaging 0.92
R6014:Dst UTSW 1 34264834 missense probably damaging 1.00
R6042:Dst UTSW 1 34188972 missense probably damaging 1.00
R6064:Dst UTSW 1 34194051 missense probably damaging 1.00
R6126:Dst UTSW 1 34228183 missense probably damaging 1.00
R6157:Dst UTSW 1 34211172 missense probably damaging 1.00
R6162:Dst UTSW 1 34006237 missense probably damaging 0.99
R6185:Dst UTSW 1 34173080 missense probably damaging 0.99
R6226:Dst UTSW 1 34270874 missense probably damaging 1.00
R6227:Dst UTSW 1 34194540 missense probably benign 0.41
R6232:Dst UTSW 1 34188172 missense probably damaging 1.00
R6259:Dst UTSW 1 34182396 missense probably benign 0.26
R6267:Dst UTSW 1 34228672 missense probably damaging 1.00
R6273:Dst UTSW 1 34275266 missense probably damaging 1.00
R6284:Dst UTSW 1 34229085 missense probably damaging 1.00
R6347:Dst UTSW 1 34179684 splice site probably null
R6365:Dst UTSW 1 34191927 missense probably damaging 1.00
R6385:Dst UTSW 1 34307468 missense possibly damaging 0.85
R6389:Dst UTSW 1 34193184 missense probably damaging 0.99
R6395:Dst UTSW 1 34182690 missense probably benign 0.17
R6416:Dst UTSW 1 34116128 missense probably damaging 1.00
R6467:Dst UTSW 1 34295196 missense probably damaging 1.00
R6470:Dst UTSW 1 34295237 missense probably damaging 1.00
R6477:Dst UTSW 1 34208728 splice site probably null
R6485:Dst UTSW 1 34294529 missense probably damaging 1.00
R6491:Dst UTSW 1 34193012 missense probably benign 0.10
R6525:Dst UTSW 1 34163135 missense probably damaging 1.00
R6533:Dst UTSW 1 34303509 missense probably benign 0.08
R6595:Dst UTSW 1 34250680 missense probably damaging 1.00
R6622:Dst UTSW 1 34179251 missense probably benign 0.22
R6646:Dst UTSW 1 34268807 missense possibly damaging 0.80
R6648:Dst UTSW 1 34262041 missense possibly damaging 0.84
R6700:Dst UTSW 1 34256323 missense probably damaging 1.00
R6743:Dst UTSW 1 34270890 missense probably damaging 1.00
R6761:Dst UTSW 1 34214550 missense probably damaging 1.00
R6766:Dst UTSW 1 34294483 missense probably damaging 1.00
R6768:Dst UTSW 1 34181712 missense probably damaging 0.98
R6810:Dst UTSW 1 34212298 missense probably damaging 1.00
R6815:Dst UTSW 1 34228369 missense possibly damaging 0.67
R6820:Dst UTSW 1 34211256 missense probably damaging 1.00
R6822:Dst UTSW 1 34275674 missense probably damaging 0.99
R6831:Dst UTSW 1 34190684 missense probably benign 0.03
R6874:Dst UTSW 1 34289651 missense probably benign 0.29
R6945:Dst UTSW 1 34190490 missense probably damaging 1.00
R6985:Dst UTSW 1 34190853 missense probably benign 0.08
R6995:Dst UTSW 1 34166234 missense probably damaging 1.00
R7038:Dst UTSW 1 34182798 nonsense probably null
R7043:Dst UTSW 1 34257911 missense probably damaging 0.99
R7070:Dst UTSW 1 34275302 missense probably damaging 1.00
R7097:Dst UTSW 1 34169260 missense probably damaging 1.00
R7139:Dst UTSW 1 34299807 missense probably damaging 0.97
R7144:Dst UTSW 1 34152243 missense probably damaging 1.00
R7145:Dst UTSW 1 34189882 missense probably benign
R7158:Dst UTSW 1 34274285 missense probably benign
R7207:Dst UTSW 1 34163337 missense probably damaging 0.98
R7320:Dst UTSW 1 34191094 missense probably benign
R7324:Dst UTSW 1 34006224 missense possibly damaging 0.93
R7327:Dst UTSW 1 34201405 missense probably damaging 1.00
R7340:Dst UTSW 1 34190729 missense probably benign 0.01
R7358:Dst UTSW 1 34191673 missense probably benign
R7373:Dst UTSW 1 34188391 missense probably benign 0.02
R7376:Dst UTSW 1 34192689 missense probably benign
R7453:Dst UTSW 1 34191358 missense possibly damaging 0.95
R7467:Dst UTSW 1 34191155 missense probably benign 0.00
R7471:Dst UTSW 1 34194570 missense possibly damaging 0.49
R7472:Dst UTSW 1 34218497 missense probably benign 0.02
R7485:Dst UTSW 1 34274189 missense probably benign 0.31
R7504:Dst UTSW 1 34201017 missense probably damaging 1.00
R7516:Dst UTSW 1 34170479 missense probably benign 0.10
R7524:Dst UTSW 1 34291893 missense possibly damaging 0.94
R7528:Dst UTSW 1 34294522 missense probably damaging 1.00
R7560:Dst UTSW 1 34182451 missense possibly damaging 0.92
R7582:Dst UTSW 1 34169883 missense probably damaging 1.00
R7585:Dst UTSW 1 34114015 missense possibly damaging 0.50
R7594:Dst UTSW 1 34213013 missense probably damaging 1.00
R7600:Dst UTSW 1 34266930 missense probably damaging 1.00
R7619:Dst UTSW 1 34199428 missense probably benign 0.02
R7623:Dst UTSW 1 34170436 missense probably damaging 0.99
R7649:Dst UTSW 1 34167697 missense probably benign 0.13
R7654:Dst UTSW 1 34228977 missense probably damaging 1.00
R7654:Dst UTSW 1 34228978 missense probably damaging 1.00
R7661:Dst UTSW 1 34256353 critical splice donor site probably null
R7667:Dst UTSW 1 34179035 missense possibly damaging 0.82
R7677:Dst UTSW 1 34169322 critical splice donor site probably null
R7698:Dst UTSW 1 34190387 missense probably benign 0.02
R7765:Dst UTSW 1 34275694 missense probably damaging 0.97
R7772:Dst UTSW 1 34181388 missense possibly damaging 0.90
R7779:Dst UTSW 1 34194597 missense probably damaging 0.99
R7791:Dst UTSW 1 34154592 missense probably damaging 0.99
R7821:Dst UTSW 1 34275362 critical splice donor site probably null
R7834:Dst UTSW 1 34194105 missense probably benign 0.22
R7935:Dst UTSW 1 34290405 missense probably damaging 1.00
R7940:Dst UTSW 1 34167676 missense possibly damaging 0.94
R7951:Dst UTSW 1 34201186 missense probably benign
R7956:Dst UTSW 1 34225618 missense probably damaging 1.00
R7970:Dst UTSW 1 34182747 missense possibly damaging 0.80
R7982:Dst UTSW 1 34182540 missense possibly damaging 0.89
R8048:Dst UTSW 1 34190636 missense probably benign 0.00
R8052:Dst UTSW 1 34284363 missense probably damaging 1.00
R8094:Dst UTSW 1 34188959 missense possibly damaging 0.76
R8116:Dst UTSW 1 34274180 missense probably benign 0.27
R8127:Dst UTSW 1 34178229 missense probably damaging 1.00
R8139:Dst UTSW 1 34191852 missense probably benign
R8205:Dst UTSW 1 34214604 missense probably damaging 1.00
R8211:Dst UTSW 1 34212451 missense probably damaging 1.00
R8237:Dst UTSW 1 34169793 missense possibly damaging 0.96
R8265:Dst UTSW 1 34178522 missense probably benign 0.13
R8309:Dst UTSW 1 34117511 missense probably damaging 1.00
R8315:Dst UTSW 1 34284420 critical splice donor site probably null
R8469:Dst UTSW 1 34229028 missense probably damaging 1.00
R8474:Dst UTSW 1 34169185 missense probably damaging 1.00
R8502:Dst UTSW 1 34167292 missense probably damaging 1.00
R8534:Dst UTSW 1 34190307 missense probably benign 0.12
R8535:Dst UTSW 1 34186001 missense probably damaging 1.00
R8536:Dst UTSW 1 34197246 missense possibly damaging 0.64
R8542:Dst UTSW 1 34192607 missense possibly damaging 0.61
R8560:Dst UTSW 1 34268889 missense probably damaging 1.00
R8737:Dst UTSW 1 34228669 missense probably benign 0.00
R8742:Dst UTSW 1 34212344 missense probably benign 0.01
R8882:Dst UTSW 1 34200924 missense probably damaging 1.00
R8894:Dst UTSW 1 34174133 missense possibly damaging 0.96
R8973:Dst UTSW 1 34228855 missense probably damaging 1.00
R8977:Dst UTSW 1 34247783 missense probably damaging 0.99
R8985:Dst UTSW 1 34249805 missense probably benign 0.00
R9001:Dst UTSW 1 34174211 missense possibly damaging 0.63
R9005:Dst UTSW 1 34228693 missense probably damaging 0.99
R9013:Dst UTSW 1 34178084 missense possibly damaging 0.46
R9015:Dst UTSW 1 34287256 missense probably benign 0.00
R9018:Dst UTSW 1 34196059 missense probably damaging 0.97
R9023:Dst UTSW 1 34114024 critical splice donor site probably null
R9025:Dst UTSW 1 34188504 missense possibly damaging 0.73
R9052:Dst UTSW 1 34166964 missense probably damaging 1.00
R9052:Dst UTSW 1 34197330 nonsense probably null
R9147:Dst UTSW 1 34189068 missense probably damaging 0.99
R9169:Dst UTSW 1 34264571 missense probably damaging 1.00
R9181:Dst UTSW 1 34192737 missense probably benign
R9224:Dst UTSW 1 34291798 missense probably damaging 1.00
R9245:Dst UTSW 1 34189862 missense probably benign
R9267:Dst UTSW 1 34193064 missense probably benign
R9302:Dst UTSW 1 34225555 missense probably damaging 1.00
R9344:Dst UTSW 1 34181595 missense probably damaging 0.99
R9363:Dst UTSW 1 34195979 missense probably damaging 1.00
R9441:Dst UTSW 1 34199351 missense probably damaging 1.00
R9477:Dst UTSW 1 34166211 missense probably damaging 1.00
R9501:Dst UTSW 1 34188768 missense probably damaging 0.98
R9509:Dst UTSW 1 33908384 missense possibly damaging 0.72
R9572:Dst UTSW 1 34211171 missense probably damaging 1.00
R9598:Dst UTSW 1 34113933 missense possibly damaging 0.79
R9651:Dst UTSW 1 34180377 missense probably benign 0.39
R9652:Dst UTSW 1 34180377 missense probably benign 0.39
R9664:Dst UTSW 1 34181655 missense probably benign 0.33
R9666:Dst UTSW 1 34179866 nonsense probably null
R9707:Dst UTSW 1 34189853 missense probably benign 0.28
R9721:Dst UTSW 1 34192785 missense probably benign
R9727:Dst UTSW 1 34275796 missense probably damaging 1.00
R9781:Dst UTSW 1 34178994 missense probably benign
R9787:Dst UTSW 1 34180443 missense probably benign 0.02
RF014:Dst UTSW 1 34247679 missense probably benign 0.00
X0026:Dst UTSW 1 34213055 missense probably damaging 0.97
X0028:Dst UTSW 1 34192199 missense probably damaging 1.00
X0063:Dst UTSW 1 34195895 missense probably damaging 1.00
X0066:Dst UTSW 1 34275703 nonsense probably null
Z1176:Dst UTSW 1 34165143 missense probably benign 0.00
Z1176:Dst UTSW 1 34188467 nonsense probably null
Z1176:Dst UTSW 1 34244445 missense probably benign 0.02
Z1176:Dst UTSW 1 34275208 missense probably damaging 1.00
Z1177:Dst UTSW 1 34181232 missense probably benign 0.15
Z1177:Dst UTSW 1 34194518 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGATTGGCTTCCTCAAG -3'
(R):5'- TCTGGAGCTTGTCTGAGAGC -3'

Sequencing Primer
(F):5'- GGATTGGCTTCCTCAAGAGAAAAACC -3'
(R):5'- GAGAGCTTCTCAAACTGCTCTAC -3'
Posted On 2015-06-10