Incidental Mutation 'R4206:Or9s14'
ID 318894
Institutional Source Beutler Lab
Gene Symbol Or9s14
Ensembl Gene ENSMUSG00000063583
Gene Name olfactory receptor family 9 subfamily S member 14
Synonyms Olfr1410, MOR208-2, GA_x6K02T2R7CC-81146179-81145211
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4206 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 92535561-92536529 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 92536317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 253 (T253P)
Ref Sequence ENSEMBL: ENSMUSP00000149621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073748] [ENSMUST00000079790] [ENSMUST00000216553] [ENSMUST00000217316]
AlphaFold E9PYK6
Predicted Effect possibly damaging
Transcript: ENSMUST00000073748
AA Change: T253P

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073422
Gene: ENSMUSG00000062497
AA Change: T253P

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:7tm_4 38 314 7.4e-53 PFAM
Pfam:7tm_1 48 297 1.2e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079790
AA Change: T253P

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078720
Gene: ENSMUSG00000063583
AA Change: T253P

DomainStartEndE-ValueType
Pfam:7tm_4 38 314 2.6e-50 PFAM
Pfam:7tm_1 48 302 9.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216553
AA Change: T253P

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217316
AA Change: T253P

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,315,435 (GRCm39) K81R probably benign Het
Acacb T C 5: 114,351,712 (GRCm39) F1150L probably benign Het
Acat3 A G 17: 13,146,273 (GRCm39) Y237H possibly damaging Het
Arfgap3 T C 15: 83,206,869 (GRCm39) T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Cabin1 T C 10: 75,590,675 (GRCm39) S23G possibly damaging Het
Cemip2 G T 19: 21,819,479 (GRCm39) R1090L probably damaging Het
Clasp1 A G 1: 118,506,636 (GRCm39) N949S probably damaging Het
Csrp1 T G 1: 135,673,065 (GRCm39) C61G probably damaging Het
Dgka A T 10: 128,557,064 (GRCm39) L637Q probably damaging Het
Dst G A 1: 34,251,328 (GRCm39) R1801H probably damaging Het
Edil3 T C 13: 89,328,397 (GRCm39) S284P probably damaging Het
Eif2d A G 1: 131,082,100 (GRCm39) Y64C probably damaging Het
Ell2 A G 13: 75,910,067 (GRCm39) D139G probably damaging Het
Fam187a A G 11: 102,777,038 (GRCm39) R281G probably damaging Het
Gin1 A G 1: 97,720,145 (GRCm39) D380G possibly damaging Het
Gpr149 T G 3: 62,511,924 (GRCm39) D25A possibly damaging Het
Gyg1 A G 3: 20,206,901 (GRCm39) S90P probably benign Het
Hpx C T 7: 105,244,354 (GRCm39) M190I probably null Het
Irf2bpl C T 12: 86,929,810 (GRCm39) V288I probably benign Het
Lyst A G 13: 13,810,574 (GRCm39) H748R probably benign Het
Mmrn1 G A 6: 60,935,164 (GRCm39) G220D probably damaging Het
Mpdz A T 4: 81,299,999 (GRCm39) M333K probably benign Het
Muc5ac C T 7: 141,370,847 (GRCm39) S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Ntsr1 A G 2: 180,142,545 (GRCm39) D112G probably damaging Het
Or56b1 T A 7: 104,285,356 (GRCm39) N158K possibly damaging Het
Or7a42 T C 10: 78,791,117 (GRCm39) F26S probably benign Het
Parg A G 14: 31,976,493 (GRCm39) K178R probably benign Het
Pde8b C A 13: 95,359,053 (GRCm39) C90F probably benign Het
Pld1 G A 3: 28,174,932 (GRCm39) V857I probably benign Het
Rad54l2 A C 9: 106,594,994 (GRCm39) V321G probably damaging Het
Rcn2 A G 9: 55,952,491 (GRCm39) Y112C possibly damaging Het
Rnf123 A T 9: 107,941,162 (GRCm39) D639E probably benign Het
Rufy2 C T 10: 62,840,551 (GRCm39) Q441* probably null Het
Scgb2b12 T C 7: 32,026,063 (GRCm39) Y43C probably damaging Het
Scrn3 T A 2: 73,149,845 (GRCm39) probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc22a8 T C 19: 8,585,597 (GRCm39) S321P probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tex2 A G 11: 106,458,398 (GRCm39) probably benign Het
Trip13 A G 13: 74,081,009 (GRCm39) I119T probably benign Het
Tsku C T 7: 98,002,205 (GRCm39) R42H probably damaging Het
Ttn A G 2: 76,602,911 (GRCm39) I16691T possibly damaging Het
Tyr A G 7: 87,078,276 (GRCm39) L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 (GRCm39) V142A probably damaging Het
Uggt2 C T 14: 119,286,674 (GRCm39) D221N probably damaging Het
Wnt4 A G 4: 137,023,654 (GRCm39) K207R possibly damaging Het
Zfp608 T C 18: 55,121,267 (GRCm39) R107G probably damaging Het
Other mutations in Or9s14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02310:Or9s14 APN 1 92,535,787 (GRCm39) missense possibly damaging 0.80
R0189:Or9s14 UTSW 1 92,535,615 (GRCm39) missense probably damaging 0.99
R0520:Or9s14 UTSW 1 92,536,471 (GRCm39) missense probably damaging 1.00
R0605:Or9s14 UTSW 1 92,535,618 (GRCm39) missense probably benign 0.02
R1568:Or9s14 UTSW 1 92,535,676 (GRCm39) missense probably damaging 1.00
R1753:Or9s14 UTSW 1 92,536,122 (GRCm39) missense probably benign 0.07
R1778:Or9s14 UTSW 1 92,535,831 (GRCm39) missense possibly damaging 0.88
R2960:Or9s14 UTSW 1 92,536,050 (GRCm39) missense probably benign 0.00
R7379:Or9s14 UTSW 1 92,536,189 (GRCm39) missense possibly damaging 0.76
R7868:Or9s14 UTSW 1 92,536,237 (GRCm39) missense possibly damaging 0.63
R8447:Or9s14 UTSW 1 92,535,494 (GRCm39) start gained probably benign
R8925:Or9s14 UTSW 1 92,536,438 (GRCm39) missense probably damaging 1.00
R8927:Or9s14 UTSW 1 92,536,438 (GRCm39) missense probably damaging 1.00
R9512:Or9s14 UTSW 1 92,535,990 (GRCm39) missense probably benign 0.00
Z1176:Or9s14 UTSW 1 92,535,473 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAGCACAGCTATCAATGAG -3'
(R):5'- TGGCTCCCAATGATGTCACTAG -3'

Sequencing Primer
(F):5'- GCACAGCTATCAATGAGCTTGTC -3'
(R):5'- AATGATGTCACTAGCCACTCTC -3'
Posted On 2015-06-10