Incidental Mutation 'R0394:Bmp1'
ID 31890
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 038600-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0394 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70727474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 703 (A703V)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably damaging
Transcript: ENSMUST00000022693
AA Change: A703V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: A703V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226601
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228501
Meta Mutation Damage Score 0.5421 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 137,773,065 (GRCm39) S751R probably damaging Het
Abca8a A G 11: 109,917,169 (GRCm39) V1610A probably damaging Het
Actl10 A T 2: 154,394,957 (GRCm39) H202L probably benign Het
Alox12 A T 11: 70,136,761 (GRCm39) V489E probably damaging Het
Ap4m1 T A 5: 138,170,465 (GRCm39) F5I probably benign Het
Atn1 T C 6: 124,726,696 (GRCm39) probably benign Het
Atrnl1 T A 19: 57,661,608 (GRCm39) N529K probably benign Het
B3gntl1 C T 11: 121,510,541 (GRCm39) G336D probably damaging Het
Brat1 T G 5: 140,704,141 (GRCm39) L798R probably damaging Het
Cacna1c C T 6: 118,602,458 (GRCm39) G1302R probably damaging Het
Cdr2 A T 7: 120,557,954 (GRCm39) D190E probably benign Het
Cenpe T C 3: 134,922,186 (GRCm39) probably benign Het
Clstn1 A G 4: 149,728,635 (GRCm39) D687G probably benign Het
Coro1a A G 7: 126,299,812 (GRCm39) F337L probably benign Het
Ddx49 T A 8: 70,749,575 (GRCm39) I252F probably damaging Het
Dennd2a T A 6: 39,499,746 (GRCm39) D273V possibly damaging Het
Derl2 A T 11: 70,905,387 (GRCm39) F32I probably benign Het
Dmrta1 A G 4: 89,580,276 (GRCm39) Y412C probably damaging Het
Dsg1a A G 18: 20,466,807 (GRCm39) N559S probably damaging Het
Dusp26 G T 8: 31,581,987 (GRCm39) R27L probably benign Het
Eif2ak3 T C 6: 70,862,202 (GRCm39) I492T probably benign Het
Exoc7 G T 11: 116,191,224 (GRCm39) Q219K probably damaging Het
F2r T C 13: 95,740,984 (GRCm39) T184A probably damaging Het
Fbf1 G A 11: 116,043,288 (GRCm39) probably benign Het
Fbxo28 A G 1: 182,144,580 (GRCm39) M328T probably benign Het
Fsip2 T A 2: 82,821,419 (GRCm39) D5717E possibly damaging Het
Gnpat C A 8: 125,606,964 (GRCm39) S373R possibly damaging Het
Golgb1 G T 16: 36,695,941 (GRCm39) probably benign Het
Greb1l T C 18: 10,523,374 (GRCm39) V844A probably damaging Het
Hps1 G T 19: 42,759,338 (GRCm39) probably null Het
Inppl1 G T 7: 101,477,402 (GRCm39) probably benign Het
Isca1 C T 13: 59,906,699 (GRCm39) probably null Het
Itgb2 T A 10: 77,378,309 (GRCm39) C46S probably damaging Het
Kifc5b C T 17: 27,142,056 (GRCm39) T178M probably benign Het
Krt80 T C 15: 101,250,180 (GRCm39) T22A probably damaging Het
L3mbtl2 C T 15: 81,552,942 (GRCm39) A125V probably damaging Het
Ltbp2 C T 12: 84,853,198 (GRCm39) probably benign Het
Mettl18 A G 1: 163,823,910 (GRCm39) D77G probably benign Het
Mfsd2a A G 4: 122,843,961 (GRCm39) L336P probably benign Het
Mgat4b A G 11: 50,121,746 (GRCm39) probably null Het
Mtmr14 C T 6: 113,257,649 (GRCm39) R233* probably null Het
Nbea T C 3: 55,937,328 (GRCm39) Y761C probably damaging Het
Neb A T 2: 52,067,571 (GRCm39) probably null Het
Nup85 T G 11: 115,455,357 (GRCm39) M1R probably null Het
Obi1 T C 14: 104,716,289 (GRCm39) R695G possibly damaging Het
Or6c70 T A 10: 129,709,811 (GRCm39) I272L probably benign Het
Oxr1 T A 15: 41,680,593 (GRCm39) M177K probably damaging Het
Pgm2l1 A G 7: 99,901,405 (GRCm39) Y98C probably damaging Het
Pi4kb G T 3: 94,904,115 (GRCm39) probably benign Het
Pi4kb G A 3: 94,904,116 (GRCm39) probably benign Het
Pirb T A 7: 3,722,247 (GRCm39) S199C probably benign Het
Prss23 A C 7: 89,159,055 (GRCm39) I338S probably damaging Het
Rapgef3 A T 15: 97,655,700 (GRCm39) probably benign Het
Rdh7 T A 10: 127,720,539 (GRCm39) T278S probably benign Het
Rrp1b A G 17: 32,277,538 (GRCm39) D606G probably benign Het
Rxfp1 T A 3: 79,559,684 (GRCm39) Y379F possibly damaging Het
Rxfp2 T C 5: 149,990,853 (GRCm39) V514A probably benign Het
Scel A T 14: 103,799,954 (GRCm39) E202V probably benign Het
Slc25a36 G A 9: 96,962,257 (GRCm39) A244V probably benign Het
Slc2a13 T G 15: 91,400,595 (GRCm39) Q209P probably damaging Het
Slc38a6 A G 12: 73,399,304 (GRCm39) N456S probably benign Het
Slc6a12 G T 6: 121,323,957 (GRCm39) probably null Het
Spag6l T C 16: 16,598,493 (GRCm39) I333V probably benign Het
Spen G A 4: 141,201,514 (GRCm39) A2371V probably benign Het
St6galnac1 T C 11: 116,657,466 (GRCm39) D366G probably damaging Het
Stk33 T C 7: 108,940,696 (GRCm39) S5G probably benign Het
Tex56 T C 13: 35,116,636 (GRCm39) probably benign Het
Tle2 T C 10: 81,413,482 (GRCm39) L84P probably damaging Het
Tmem14a T C 1: 21,296,876 (GRCm39) M78T probably damaging Het
Top2b T A 14: 16,413,556 (GRCm38) probably null Het
Trmt13 A G 3: 116,376,299 (GRCm39) F364S probably damaging Het
Unkl T A 17: 25,449,751 (GRCm39) probably null Het
Uvrag A G 7: 98,653,926 (GRCm39) probably benign Het
Vmn2r8 T A 5: 108,949,938 (GRCm39) N303I probably benign Het
Vsig10l A G 7: 43,114,879 (GRCm39) N360S probably damaging Het
Zdhhc25 T C 15: 88,485,123 (GRCm39) Y153H probably damaging Het
Zfp646 T C 7: 127,482,434 (GRCm39) V1537A possibly damaging Het
Zfp664 T A 5: 124,963,129 (GRCm39) Y174* probably null Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGGCAATTGAACTCCCTGTCC -3'
(R):5'- ACACACAGCAGCGTTTTGTTGG -3'

Sequencing Primer
(F):5'- AGGACCTCCCCTTTCAGG -3'
(R):5'- GCAGATGCTTAGCCTGACAC -3'
Posted On 2013-04-24