Incidental Mutation 'R4206:4921509C19Rik'
ID 318901
Institutional Source Beutler Lab
Gene Symbol 4921509C19Rik
Ensembl Gene ENSMUSG00000061525
Gene Name RIKEN cDNA 4921509C19 gene
Synonyms LOC381389
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4206 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 151312462-151318073 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 151315435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 81 (K81R)
Ref Sequence ENSEMBL: ENSMUSP00000079030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080132]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080132
AA Change: K81R

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079030
Gene: ENSMUSG00000061525
AA Change: K81R

DomainStartEndE-ValueType
S_TKc 24 271 2.18e-97 SMART
low complexity region 430 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155885
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,351,712 (GRCm39) F1150L probably benign Het
Acat3 A G 17: 13,146,273 (GRCm39) Y237H possibly damaging Het
Arfgap3 T C 15: 83,206,869 (GRCm39) T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Cabin1 T C 10: 75,590,675 (GRCm39) S23G possibly damaging Het
Cemip2 G T 19: 21,819,479 (GRCm39) R1090L probably damaging Het
Clasp1 A G 1: 118,506,636 (GRCm39) N949S probably damaging Het
Csrp1 T G 1: 135,673,065 (GRCm39) C61G probably damaging Het
Dgka A T 10: 128,557,064 (GRCm39) L637Q probably damaging Het
Dst G A 1: 34,251,328 (GRCm39) R1801H probably damaging Het
Edil3 T C 13: 89,328,397 (GRCm39) S284P probably damaging Het
Eif2d A G 1: 131,082,100 (GRCm39) Y64C probably damaging Het
Ell2 A G 13: 75,910,067 (GRCm39) D139G probably damaging Het
Fam187a A G 11: 102,777,038 (GRCm39) R281G probably damaging Het
Gin1 A G 1: 97,720,145 (GRCm39) D380G possibly damaging Het
Gpr149 T G 3: 62,511,924 (GRCm39) D25A possibly damaging Het
Gyg1 A G 3: 20,206,901 (GRCm39) S90P probably benign Het
Hpx C T 7: 105,244,354 (GRCm39) M190I probably null Het
Irf2bpl C T 12: 86,929,810 (GRCm39) V288I probably benign Het
Lyst A G 13: 13,810,574 (GRCm39) H748R probably benign Het
Mmrn1 G A 6: 60,935,164 (GRCm39) G220D probably damaging Het
Mpdz A T 4: 81,299,999 (GRCm39) M333K probably benign Het
Muc5ac C T 7: 141,370,847 (GRCm39) S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Ntsr1 A G 2: 180,142,545 (GRCm39) D112G probably damaging Het
Or56b1 T A 7: 104,285,356 (GRCm39) N158K possibly damaging Het
Or7a42 T C 10: 78,791,117 (GRCm39) F26S probably benign Het
Or9s14 A C 1: 92,536,317 (GRCm39) T253P possibly damaging Het
Parg A G 14: 31,976,493 (GRCm39) K178R probably benign Het
Pde8b C A 13: 95,359,053 (GRCm39) C90F probably benign Het
Pld1 G A 3: 28,174,932 (GRCm39) V857I probably benign Het
Rad54l2 A C 9: 106,594,994 (GRCm39) V321G probably damaging Het
Rcn2 A G 9: 55,952,491 (GRCm39) Y112C possibly damaging Het
Rnf123 A T 9: 107,941,162 (GRCm39) D639E probably benign Het
Rufy2 C T 10: 62,840,551 (GRCm39) Q441* probably null Het
Scgb2b12 T C 7: 32,026,063 (GRCm39) Y43C probably damaging Het
Scrn3 T A 2: 73,149,845 (GRCm39) probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc22a8 T C 19: 8,585,597 (GRCm39) S321P probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tex2 A G 11: 106,458,398 (GRCm39) probably benign Het
Trip13 A G 13: 74,081,009 (GRCm39) I119T probably benign Het
Tsku C T 7: 98,002,205 (GRCm39) R42H probably damaging Het
Ttn A G 2: 76,602,911 (GRCm39) I16691T possibly damaging Het
Tyr A G 7: 87,078,276 (GRCm39) L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 (GRCm39) V142A probably damaging Het
Uggt2 C T 14: 119,286,674 (GRCm39) D221N probably damaging Het
Wnt4 A G 4: 137,023,654 (GRCm39) K207R possibly damaging Het
Zfp608 T C 18: 55,121,267 (GRCm39) R107G probably damaging Het
Other mutations in 4921509C19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:4921509C19Rik APN 2 151,315,453 (GRCm39) missense possibly damaging 0.46
IGL02117:4921509C19Rik APN 2 151,315,466 (GRCm39) missense probably benign 0.10
IGL02432:4921509C19Rik APN 2 151,314,481 (GRCm39) missense probably benign 0.18
IGL03025:4921509C19Rik APN 2 151,315,405 (GRCm39) missense possibly damaging 0.82
R0321:4921509C19Rik UTSW 2 151,314,620 (GRCm39) missense probably benign 0.01
R0961:4921509C19Rik UTSW 2 151,314,686 (GRCm39) missense probably benign 0.01
R1272:4921509C19Rik UTSW 2 151,313,977 (GRCm39) missense probably damaging 0.98
R1455:4921509C19Rik UTSW 2 151,314,824 (GRCm39) missense possibly damaging 0.46
R3177:4921509C19Rik UTSW 2 151,314,020 (GRCm39) missense possibly damaging 0.65
R3277:4921509C19Rik UTSW 2 151,314,020 (GRCm39) missense possibly damaging 0.65
R4655:4921509C19Rik UTSW 2 151,314,778 (GRCm39) missense probably benign 0.03
R4680:4921509C19Rik UTSW 2 151,315,390 (GRCm39) missense probably damaging 1.00
R4684:4921509C19Rik UTSW 2 151,313,791 (GRCm39) missense unknown
R4702:4921509C19Rik UTSW 2 151,314,509 (GRCm39) missense probably benign 0.00
R4867:4921509C19Rik UTSW 2 151,314,742 (GRCm39) nonsense probably null
R4962:4921509C19Rik UTSW 2 151,314,728 (GRCm39) missense possibly damaging 0.78
R5117:4921509C19Rik UTSW 2 151,314,460 (GRCm39) missense probably benign 0.00
R5484:4921509C19Rik UTSW 2 151,313,851 (GRCm39) missense probably benign
R5602:4921509C19Rik UTSW 2 151,315,459 (GRCm39) missense possibly damaging 0.83
R6374:4921509C19Rik UTSW 2 151,314,800 (GRCm39) missense possibly damaging 0.47
R6894:4921509C19Rik UTSW 2 151,315,227 (GRCm39) missense probably damaging 1.00
R7079:4921509C19Rik UTSW 2 151,315,198 (GRCm39) missense probably damaging 1.00
R7109:4921509C19Rik UTSW 2 151,315,673 (GRCm39) missense probably damaging 1.00
R7155:4921509C19Rik UTSW 2 151,315,489 (GRCm39) missense possibly damaging 0.69
R7441:4921509C19Rik UTSW 2 151,314,845 (GRCm39) missense possibly damaging 0.51
R7845:4921509C19Rik UTSW 2 151,314,229 (GRCm39) missense probably damaging 0.96
R7853:4921509C19Rik UTSW 2 151,315,600 (GRCm39) missense probably damaging 1.00
R8773:4921509C19Rik UTSW 2 151,314,062 (GRCm39) missense possibly damaging 0.91
R8805:4921509C19Rik UTSW 2 151,313,285 (GRCm39) splice site probably benign
R8983:4921509C19Rik UTSW 2 151,313,272 (GRCm39) missense unknown
R9257:4921509C19Rik UTSW 2 151,315,627 (GRCm39) missense probably benign 0.05
R9566:4921509C19Rik UTSW 2 151,314,226 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGCTTTAAATCCCTGTGGAC -3'
(R):5'- TAACACCTTTGAAGACGCTGCC -3'

Sequencing Primer
(F):5'- GGCTTTAAATCCCTGTGGACAATCC -3'
(R):5'- CTTTGAAGACGCTGCCTTAACAG -3'
Posted On 2015-06-10