Incidental Mutation 'R4206:Pld1'
ID 318904
Institutional Source Beutler Lab
Gene Symbol Pld1
Ensembl Gene ENSMUSG00000027695
Gene Name phospholipase D1
Synonyms Pld1a, Pld1b
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4206 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 27992844-28187511 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 28174932 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 857 (V857I)
Ref Sequence ENSEMBL: ENSMUSP00000113810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067757] [ENSMUST00000120834] [ENSMUST00000123539]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067757
AA Change: V857I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695
AA Change: V857I

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120834
AA Change: V857I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695
AA Change: V857I

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123539
AA Change: V895I
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695
AA Change: V895I

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126594
AA Change: V77I
SMART Domains Protein: ENSMUSP00000121569
Gene: ENSMUSG00000027695
AA Change: V77I

DomainStartEndE-ValueType
PLDc 74 101 1.34e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148827
AA Change: V668I
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695
AA Change: V668I

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylcholine-specific phospholipase which catalyzes the hydrolysis of phosphatidylcholine in order to yield phosphatidic acid and choline. The enzyme may play a role in signal transduction and subcellular trafficking. Alternative splicing results in multiple transcript variants with both catalytic and regulatory properties. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a null allele show reduced tumor growth and angiogenesis. Homozygotes for a second null allele show abnormal hepatic autophagy after food restriction. Homozygotes for a third null allele show altered platelet activation and protection from thrombosis and ischemic brain injury. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,315,435 (GRCm39) K81R probably benign Het
Acacb T C 5: 114,351,712 (GRCm39) F1150L probably benign Het
Acat3 A G 17: 13,146,273 (GRCm39) Y237H possibly damaging Het
Arfgap3 T C 15: 83,206,869 (GRCm39) T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Cabin1 T C 10: 75,590,675 (GRCm39) S23G possibly damaging Het
Cemip2 G T 19: 21,819,479 (GRCm39) R1090L probably damaging Het
Clasp1 A G 1: 118,506,636 (GRCm39) N949S probably damaging Het
Csrp1 T G 1: 135,673,065 (GRCm39) C61G probably damaging Het
Dgka A T 10: 128,557,064 (GRCm39) L637Q probably damaging Het
Dst G A 1: 34,251,328 (GRCm39) R1801H probably damaging Het
Edil3 T C 13: 89,328,397 (GRCm39) S284P probably damaging Het
Eif2d A G 1: 131,082,100 (GRCm39) Y64C probably damaging Het
Ell2 A G 13: 75,910,067 (GRCm39) D139G probably damaging Het
Fam187a A G 11: 102,777,038 (GRCm39) R281G probably damaging Het
Gin1 A G 1: 97,720,145 (GRCm39) D380G possibly damaging Het
Gpr149 T G 3: 62,511,924 (GRCm39) D25A possibly damaging Het
Gyg1 A G 3: 20,206,901 (GRCm39) S90P probably benign Het
Hpx C T 7: 105,244,354 (GRCm39) M190I probably null Het
Irf2bpl C T 12: 86,929,810 (GRCm39) V288I probably benign Het
Lyst A G 13: 13,810,574 (GRCm39) H748R probably benign Het
Mmrn1 G A 6: 60,935,164 (GRCm39) G220D probably damaging Het
Mpdz A T 4: 81,299,999 (GRCm39) M333K probably benign Het
Muc5ac C T 7: 141,370,847 (GRCm39) S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Ntsr1 A G 2: 180,142,545 (GRCm39) D112G probably damaging Het
Or56b1 T A 7: 104,285,356 (GRCm39) N158K possibly damaging Het
Or7a42 T C 10: 78,791,117 (GRCm39) F26S probably benign Het
Or9s14 A C 1: 92,536,317 (GRCm39) T253P possibly damaging Het
Parg A G 14: 31,976,493 (GRCm39) K178R probably benign Het
Pde8b C A 13: 95,359,053 (GRCm39) C90F probably benign Het
Rad54l2 A C 9: 106,594,994 (GRCm39) V321G probably damaging Het
Rcn2 A G 9: 55,952,491 (GRCm39) Y112C possibly damaging Het
Rnf123 A T 9: 107,941,162 (GRCm39) D639E probably benign Het
Rufy2 C T 10: 62,840,551 (GRCm39) Q441* probably null Het
Scgb2b12 T C 7: 32,026,063 (GRCm39) Y43C probably damaging Het
Scrn3 T A 2: 73,149,845 (GRCm39) probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc22a8 T C 19: 8,585,597 (GRCm39) S321P probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tex2 A G 11: 106,458,398 (GRCm39) probably benign Het
Trip13 A G 13: 74,081,009 (GRCm39) I119T probably benign Het
Tsku C T 7: 98,002,205 (GRCm39) R42H probably damaging Het
Ttn A G 2: 76,602,911 (GRCm39) I16691T possibly damaging Het
Tyr A G 7: 87,078,276 (GRCm39) L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 (GRCm39) V142A probably damaging Het
Uggt2 C T 14: 119,286,674 (GRCm39) D221N probably damaging Het
Wnt4 A G 4: 137,023,654 (GRCm39) K207R possibly damaging Het
Zfp608 T C 18: 55,121,267 (GRCm39) R107G probably damaging Het
Other mutations in Pld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Pld1 APN 3 28,099,247 (GRCm39) critical splice donor site probably null
IGL01090:Pld1 APN 3 28,142,816 (GRCm39) missense probably benign 0.01
IGL01140:Pld1 APN 3 28,132,386 (GRCm39) missense probably benign 0.01
IGL01646:Pld1 APN 3 28,153,813 (GRCm39) missense probably damaging 1.00
IGL01830:Pld1 APN 3 28,102,153 (GRCm39) splice site probably benign
IGL01946:Pld1 APN 3 28,178,766 (GRCm39) missense probably damaging 1.00
IGL02139:Pld1 APN 3 28,174,961 (GRCm39) missense probably damaging 0.98
IGL02189:Pld1 APN 3 28,174,932 (GRCm39) missense probably benign 0.03
IGL02476:Pld1 APN 3 28,102,188 (GRCm39) missense probably damaging 1.00
IGL02540:Pld1 APN 3 28,083,309 (GRCm39) unclassified probably benign
IGL02649:Pld1 APN 3 28,141,378 (GRCm39) missense probably damaging 0.98
IGL02720:Pld1 APN 3 28,141,411 (GRCm39) missense probably damaging 1.00
IGL02831:Pld1 APN 3 28,130,574 (GRCm39) missense probably damaging 0.99
IGL02953:Pld1 APN 3 28,166,396 (GRCm39) missense probably benign 0.03
IGL03005:Pld1 APN 3 28,141,402 (GRCm39) missense possibly damaging 0.78
IGL03251:Pld1 APN 3 28,142,814 (GRCm39) missense probably benign 0.06
IGL03331:Pld1 APN 3 28,139,994 (GRCm39) missense probably damaging 1.00
A9681:Pld1 UTSW 3 28,139,981 (GRCm39) missense probably benign 0.01
IGL03134:Pld1 UTSW 3 28,083,316 (GRCm39) missense probably benign 0.01
P0023:Pld1 UTSW 3 28,102,274 (GRCm39) missense probably damaging 1.00
R0054:Pld1 UTSW 3 28,150,033 (GRCm39) splice site probably benign
R0054:Pld1 UTSW 3 28,150,033 (GRCm39) splice site probably benign
R0282:Pld1 UTSW 3 28,132,422 (GRCm39) missense probably benign
R0372:Pld1 UTSW 3 28,142,787 (GRCm39) splice site probably null
R0454:Pld1 UTSW 3 28,178,724 (GRCm39) missense probably damaging 1.00
R0492:Pld1 UTSW 3 28,163,966 (GRCm39) missense probably damaging 0.96
R0505:Pld1 UTSW 3 28,174,971 (GRCm39) missense possibly damaging 0.69
R0667:Pld1 UTSW 3 28,133,327 (GRCm39) splice site probably null
R0678:Pld1 UTSW 3 28,174,933 (GRCm39) missense probably damaging 0.99
R0980:Pld1 UTSW 3 28,178,724 (GRCm39) missense probably damaging 1.00
R1200:Pld1 UTSW 3 28,103,435 (GRCm39) missense probably damaging 1.00
R1235:Pld1 UTSW 3 28,082,883 (GRCm39) missense probably benign 0.05
R1657:Pld1 UTSW 3 28,125,336 (GRCm39) missense probably benign 0.04
R1670:Pld1 UTSW 3 28,103,389 (GRCm39) missense probably benign 0.17
R1705:Pld1 UTSW 3 28,125,426 (GRCm39) critical splice donor site probably null
R1815:Pld1 UTSW 3 28,163,917 (GRCm39) missense probably benign 0.04
R2215:Pld1 UTSW 3 28,132,542 (GRCm39) missense probably benign 0.16
R3435:Pld1 UTSW 3 28,178,772 (GRCm39) missense probably benign 0.13
R3522:Pld1 UTSW 3 28,085,396 (GRCm39) missense probably damaging 1.00
R4553:Pld1 UTSW 3 28,178,851 (GRCm39) missense probably benign
R4612:Pld1 UTSW 3 28,185,882 (GRCm39) missense possibly damaging 0.92
R4623:Pld1 UTSW 3 28,083,393 (GRCm39) missense probably benign 0.01
R4840:Pld1 UTSW 3 28,130,700 (GRCm39) missense probably benign 0.10
R4869:Pld1 UTSW 3 28,163,951 (GRCm39) missense possibly damaging 0.84
R4982:Pld1 UTSW 3 28,085,447 (GRCm39) missense probably damaging 0.97
R5087:Pld1 UTSW 3 28,178,731 (GRCm39) missense probably damaging 1.00
R5182:Pld1 UTSW 3 28,099,230 (GRCm39) missense probably damaging 1.00
R5384:Pld1 UTSW 3 28,079,469 (GRCm39) missense probably damaging 1.00
R6243:Pld1 UTSW 3 28,149,954 (GRCm39) missense probably damaging 0.98
R6345:Pld1 UTSW 3 28,184,896 (GRCm39) intron probably benign
R6692:Pld1 UTSW 3 28,095,348 (GRCm39) missense probably benign 0.15
R6881:Pld1 UTSW 3 28,132,563 (GRCm39) missense possibly damaging 0.77
R7197:Pld1 UTSW 3 28,078,401 (GRCm39) missense probably damaging 1.00
R7267:Pld1 UTSW 3 28,130,550 (GRCm39) missense probably damaging 1.00
R7284:Pld1 UTSW 3 28,185,882 (GRCm39) missense possibly damaging 0.92
R7293:Pld1 UTSW 3 28,141,435 (GRCm39) missense probably damaging 0.99
R7440:Pld1 UTSW 3 28,095,419 (GRCm39) missense probably benign 0.01
R7524:Pld1 UTSW 3 28,078,470 (GRCm39) missense possibly damaging 0.77
R7747:Pld1 UTSW 3 28,141,338 (GRCm39) missense possibly damaging 0.66
R7882:Pld1 UTSW 3 28,099,158 (GRCm39) missense probably damaging 1.00
R7936:Pld1 UTSW 3 28,130,651 (GRCm39) missense probably damaging 1.00
R8033:Pld1 UTSW 3 28,083,359 (GRCm39) missense probably benign 0.02
R8269:Pld1 UTSW 3 28,079,388 (GRCm39) missense probably benign 0.17
R8316:Pld1 UTSW 3 28,078,361 (GRCm39) missense probably benign
R8427:Pld1 UTSW 3 28,142,795 (GRCm39) missense probably damaging 0.97
R8523:Pld1 UTSW 3 28,140,025 (GRCm39) missense probably damaging 1.00
R8832:Pld1 UTSW 3 28,177,846 (GRCm39) missense
R8850:Pld1 UTSW 3 28,166,439 (GRCm39) missense possibly damaging 0.88
R9143:Pld1 UTSW 3 28,132,643 (GRCm39) intron probably benign
R9549:Pld1 UTSW 3 28,125,381 (GRCm39) missense possibly damaging 0.89
R9648:Pld1 UTSW 3 28,174,900 (GRCm39) missense probably damaging 0.99
Z1088:Pld1 UTSW 3 28,083,392 (GRCm39) missense probably benign
Z1176:Pld1 UTSW 3 28,185,726 (GRCm39) nonsense probably null
Z1176:Pld1 UTSW 3 28,130,682 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGTAGCCTGCTTAAGTGGC -3'
(R):5'- GTGCAAAGTCCCTTTCATTGC -3'

Sequencing Primer
(F):5'- GCCTGCTTAAGTGGCATATATATCTG -3'
(R):5'- CACACAAAATGGTTTAGGAAGAGTAC -3'
Posted On 2015-06-10