Incidental Mutation 'R4206:Gpr149'
ID 318906
Institutional Source Beutler Lab
Gene Symbol Gpr149
Ensembl Gene ENSMUSG00000043441
Gene Name G protein-coupled receptor 149
Synonyms PGR10, R35, Ieda, 9630018L10Rik
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R4206 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 62529077-62605140 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 62604503 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 25 (D25A)
Ref Sequence ENSEMBL: ENSMUSP00000060893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058535]
AlphaFold Q3UVY1
Predicted Effect possibly damaging
Transcript: ENSMUST00000058535
AA Change: D25A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060893
Gene: ENSMUSG00000043441
AA Change: D25A

DomainStartEndE-ValueType
Pfam:7tm_1 52 363 7.2e-7 PFAM
coiled coil region 694 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149007
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit increased fertility with increased litter size and frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,473,515 K81R probably benign Het
Acacb T C 5: 114,213,651 F1150L probably benign Het
Acat3 A G 17: 12,927,386 Y237H possibly damaging Het
Arfgap3 T C 15: 83,322,668 T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cabin1 T C 10: 75,754,841 S23G possibly damaging Het
Clasp1 A G 1: 118,578,906 N949S probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dgka A T 10: 128,721,195 L637Q probably damaging Het
Dst G A 1: 34,212,247 R1801H probably damaging Het
Edil3 T C 13: 89,180,278 S284P probably damaging Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Ell2 A G 13: 75,761,948 D139G probably damaging Het
Fam187a A G 11: 102,886,212 R281G probably damaging Het
Gin1 A G 1: 97,792,420 D380G possibly damaging Het
Gyg A G 3: 20,152,737 S90P probably benign Het
Hpx C T 7: 105,595,147 M190I probably null Het
Irf2bpl C T 12: 86,883,036 V288I probably benign Het
Lyst A G 13: 13,635,989 H748R probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mpdz A T 4: 81,381,762 M333K probably benign Het
Muc5ac C T 7: 141,817,110 S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntsr1 A G 2: 180,500,752 D112G probably damaging Het
Olfr1410 A C 1: 92,608,595 T253P possibly damaging Het
Olfr657 T A 7: 104,636,149 N158K possibly damaging Het
Olfr8 T C 10: 78,955,283 F26S probably benign Het
Parg A G 14: 32,254,536 K178R probably benign Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pld1 G A 3: 28,120,783 V857I probably benign Het
Rad54l2 A C 9: 106,717,795 V321G probably damaging Het
Rcn2 A G 9: 56,045,207 Y112C possibly damaging Het
Rnf123 A T 9: 108,063,963 D639E probably benign Het
Rufy2 C T 10: 63,004,772 Q441* probably null Het
Scgb2b12 T C 7: 32,326,638 Y43C probably damaging Het
Scrn3 T A 2: 73,319,501 probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc22a8 T C 19: 8,608,233 S321P probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tex2 A G 11: 106,567,572 probably benign Het
Tmem2 G T 19: 21,842,115 R1090L probably damaging Het
Trip13 A G 13: 73,932,890 I119T probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Ttn A G 2: 76,772,567 I16691T possibly damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 V142A probably damaging Het
Uggt2 C T 14: 119,049,262 D221N probably damaging Het
Wnt4 A G 4: 137,296,343 K207R possibly damaging Het
Zfp608 T C 18: 54,988,195 R107G probably damaging Het
Other mutations in Gpr149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Gpr149 APN 3 62530673 missense probably damaging 1.00
IGL01339:Gpr149 APN 3 62604297 missense probably damaging 1.00
IGL01399:Gpr149 APN 3 62604431 missense probably damaging 1.00
IGL01954:Gpr149 APN 3 62530927 missense probably benign 0.36
IGL02115:Gpr149 APN 3 62594915 missense probably benign 0.02
IGL02218:Gpr149 APN 3 62530531 utr 3 prime probably benign
IGL02592:Gpr149 APN 3 62603810 missense possibly damaging 0.75
IGL03393:Gpr149 APN 3 62603945 missense probably benign 0.15
R0578:Gpr149 UTSW 3 62602689 missense possibly damaging 0.81
R1173:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1174:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1175:Gpr149 UTSW 3 62604467 missense probably damaging 1.00
R1432:Gpr149 UTSW 3 62531018 missense probably damaging 1.00
R1484:Gpr149 UTSW 3 62595171 missense probably benign 0.00
R1972:Gpr149 UTSW 3 62530795 missense probably benign 0.39
R1973:Gpr149 UTSW 3 62530795 missense probably benign 0.39
R2180:Gpr149 UTSW 3 62604068 missense probably damaging 1.00
R2241:Gpr149 UTSW 3 62604053 missense probably benign 0.00
R3118:Gpr149 UTSW 3 62595022 missense probably benign 0.00
R3547:Gpr149 UTSW 3 62595128 missense probably benign 0.01
R3548:Gpr149 UTSW 3 62595128 missense probably benign 0.01
R4332:Gpr149 UTSW 3 62604373 missense possibly damaging 0.93
R4531:Gpr149 UTSW 3 62602678 missense probably benign 0.00
R4557:Gpr149 UTSW 3 62530870 missense probably damaging 1.00
R4557:Gpr149 UTSW 3 62604497 missense probably benign 0.02
R4593:Gpr149 UTSW 3 62602730 intron probably benign
R5397:Gpr149 UTSW 3 62530805 missense probably damaging 1.00
R6592:Gpr149 UTSW 3 62530540 missense probably benign 0.02
R6642:Gpr149 UTSW 3 62530574 missense probably damaging 1.00
R6845:Gpr149 UTSW 3 62604521 missense possibly damaging 0.58
R7303:Gpr149 UTSW 3 62595070 missense possibly damaging 0.59
R7659:Gpr149 UTSW 3 62603835 missense probably benign 0.01
R7682:Gpr149 UTSW 3 62530739 missense probably damaging 1.00
R7803:Gpr149 UTSW 3 62530715 missense probably damaging 1.00
R7904:Gpr149 UTSW 3 62594935 missense probably benign 0.00
R7943:Gpr149 UTSW 3 62530711 missense probably damaging 1.00
R8844:Gpr149 UTSW 3 62595151 missense probably benign 0.05
R8919:Gpr149 UTSW 3 62531057 missense probably damaging 1.00
R9043:Gpr149 UTSW 3 62603939 missense probably damaging 1.00
R9209:Gpr149 UTSW 3 62603672 missense probably benign 0.40
Z1177:Gpr149 UTSW 3 62603959 frame shift probably null
Z1190:Gpr149 UTSW 3 62604551 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGGCCACTGTAAAACCATGAAG -3'
(R):5'- GGAGACATGTCTGGACCAAC -3'

Sequencing Primer
(F):5'- CCATGAAGATGGCCACGGAC -3'
(R):5'- GAGACATGTCTGGACCAACACATG -3'
Posted On 2015-06-10