Mutagenetix > Incidental Mutation

Incidental Mutation 'R0394:Scel'

31891

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

038600-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0394 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103562518 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 202 (E202V)

Ref Sequence

ENSEMBL: ENSMUSP00000154402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

AlphaFold

Q9EQG3

Predicted Effect

probably benign
Transcript: ENSMUST00000095576
AA Change: E202V

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: E202V

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227322
AA Change: E202V

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0643

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 92.0%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	A	3: 138,067,304	S751R	probably damaging	Het
4933417A18Rik	T	C	13: 34,932,653		probably benign	Het
Abca8a	A	G	11: 110,026,343	V1610A	probably damaging	Het
Actl10	A	T	2: 154,553,037	H202L	probably benign	Het
Alox12	A	T	11: 70,245,935	V489E	probably damaging	Het
Ap4m1	T	A	5: 138,172,203	F5I	probably benign	Het
Atn1	T	C	6: 124,749,733		probably benign	Het
Atrnl1	T	A	19: 57,673,176	N529K	probably benign	Het
B3gntl1	C	T	11: 121,619,715	G336D	probably damaging	Het
Bmp1	G	A	14: 70,490,034	A703V	probably damaging	Het
Brat1	T	G	5: 140,718,386	L798R	probably damaging	Het
Cacna1c	C	T	6: 118,625,497	G1302R	probably damaging	Het
Cdr2	A	T	7: 120,958,731	D190E	probably benign	Het
Cenpe	T	C	3: 135,216,425		probably benign	Het
Clstn1	A	G	4: 149,644,178	D687G	probably benign	Het
Coro1a	A	G	7: 126,700,640	F337L	probably benign	Het
Ddx49	T	A	8: 70,296,925	I252F	probably damaging	Het
Dennd2a	T	A	6: 39,522,812	D273V	possibly damaging	Het
Derl2	A	T	11: 71,014,561	F32I	probably benign	Het
Dmrta1	A	G	4: 89,692,039	Y412C	probably damaging	Het
Dsg1a	A	G	18: 20,333,750	N559S	probably damaging	Het
Dusp26	G	T	8: 31,091,959	R27L	probably benign	Het
Eif2ak3	T	C	6: 70,885,218	I492T	probably benign	Het
Exoc7	G	T	11: 116,300,398	Q219K	probably damaging	Het
F2r	T	C	13: 95,604,476	T184A	probably damaging	Het
Fbf1	G	A	11: 116,152,462		probably benign	Het
Fbxo28	A	G	1: 182,317,015	M328T	probably benign	Het
Fsip2	T	A	2: 82,991,075	D5717E	possibly damaging	Het
Gnpat	C	A	8: 124,880,225	S373R	possibly damaging	Het
Golgb1	G	T	16: 36,875,579		probably benign	Het
Greb1l	T	C	18: 10,523,374	V844A	probably damaging	Het
Hps1	G	T	19: 42,770,899		probably null	Het
Inppl1	G	T	7: 101,828,195		probably benign	Het
Isca1	C	T	13: 59,758,885		probably null	Het
Itgb2	T	A	10: 77,542,475	C46S	probably damaging	Het
Kifc5b	C	T	17: 26,923,082	T178M	probably benign	Het
Krt80	T	C	15: 101,352,299	T22A	probably damaging	Het
L3mbtl2	C	T	15: 81,668,741	A125V	probably damaging	Het
Ltbp2	C	T	12: 84,806,424		probably benign	Het
Mettl18	A	G	1: 163,996,341	D77G	probably benign	Het
Mfsd2a	A	G	4: 122,950,168	L336P	probably benign	Het
Mgat4b	A	G	11: 50,230,919		probably null	Het
Mtmr14	C	T	6: 113,280,688	R233*	probably null	Het
Nbea	T	C	3: 56,029,907	Y761C	probably damaging	Het
Neb	A	T	2: 52,177,559		probably null	Het
Nup85	T	G	11: 115,564,531	M1R	probably null	Het
Olfr814	T	A	10: 129,873,942	I272L	probably benign	Het
Oxr1	T	A	15: 41,817,197	M177K	probably damaging	Het
Pgm2l1	A	G	7: 100,252,198	Y98C	probably damaging	Het
Pi4kb	G	T	3: 94,996,804		probably benign	Het
Pi4kb	G	A	3: 94,996,805		probably benign	Het
Pirb	T	A	7: 3,719,248	S199C	probably benign	Het
Prss23	A	C	7: 89,509,847	I338S	probably damaging	Het
Rapgef3	A	T	15: 97,757,819		probably benign	Het
Rdh7	T	A	10: 127,884,670	T278S	probably benign	Het
Rnf219	T	C	14: 104,478,853	R695G	possibly damaging	Het
Rrp1b	A	G	17: 32,058,564	D606G	probably benign	Het
Rxfp1	T	A	3: 79,652,377	Y379F	possibly damaging	Het
Rxfp2	T	C	5: 150,067,388	V514A	probably benign	Het
Slc25a36	G	A	9: 97,080,204	A244V	probably benign	Het
Slc2a13	T	G	15: 91,516,392	Q209P	probably damaging	Het
Slc38a6	A	G	12: 73,352,530	N456S	probably benign	Het
Slc6a12	G	T	6: 121,346,998		probably null	Het
Spag6l	T	C	16: 16,780,629	I333V	probably benign	Het
Spen	G	A	4: 141,474,203	A2371V	probably benign	Het
St6galnac1	T	C	11: 116,766,640	D366G	probably damaging	Het
Stk33	T	C	7: 109,341,489	S5G	probably benign	Het
Tle2	T	C	10: 81,577,648	L84P	probably damaging	Het
Tmem14a	T	C	1: 21,226,652	M78T	probably damaging	Het
Top2b	T	A	14: 16,413,556		probably null	Het
Trmt13	A	G	3: 116,582,650	F364S	probably damaging	Het
Unkl	T	A	17: 25,230,777		probably null	Het
Uvrag	A	G	7: 99,004,719		probably benign	Het
Vmn2r8	T	A	5: 108,802,072	N303I	probably benign	Het
Vsig10l	A	G	7: 43,465,455	N360S	probably damaging	Het
Zdhhc25	T	C	15: 88,600,920	Y153H	probably damaging	Het
Zfp646	T	C	7: 127,883,262	V1537A	possibly damaging	Het
Zfp664	T	A	5: 124,886,065	Y174*	probably null	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
R8924:Scel	UTSW	14	103592371	missense	possibly damaging	0.66
R9014:Scel	UTSW	14	103585139	missense	probably benign
R9130:Scel	UTSW	14	103533310	missense	probably benign	0.05
R9135:Scel	UTSW	14	103602190	missense	probably benign
R9179:Scel	UTSW	14	103574400	missense	possibly damaging	0.79
R9614:Scel	UTSW	14	103605596	missense	probably damaging	1.00
R9638:Scel	UTSW	14	103541973	missense	possibly damaging	0.89
R9672:Scel	UTSW	14	103599402	missense	possibly damaging	0.82
R9719:Scel	UTSW	14	103572006	critical splice acceptor site	probably null
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GGCCCTTCTTGGTACGGTAGAGATA -3'
(R):5'- TGCATTTGTGATGGTAAATCTTGCGAC -3'

Sequencing Primer
(F):5'- GCACCTTGTACATTTTAGATAGACC -3'
(R):5'- gaggcagaggcaggtgg -3'

Posted On

2013-04-24