Incidental Mutation 'R4206:Tsku'
ID 318915
Institutional Source Beutler Lab
Gene Symbol Tsku
Ensembl Gene ENSMUSG00000049580
Gene Name tsukushi, small leucine rich proteoglycan
Synonyms 9530051K01Rik, Lrrc54
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R4206 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 97999875-98010535 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98002205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 42 (R42H)
Ref Sequence ENSEMBL: ENSMUSP00000146025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094161] [ENSMUST00000164726] [ENSMUST00000165257] [ENSMUST00000165901] [ENSMUST00000167405] [ENSMUST00000179780] [ENSMUST00000206414]
AlphaFold Q8CBR6
Predicted Effect probably damaging
Transcript: ENSMUST00000094161
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091713
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164726
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130917
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165257
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128431
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165901
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127242
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167405
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131789
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179780
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137437
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206414
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206770
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a failure of anterior commissure axons to cross the midline. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,315,435 (GRCm39) K81R probably benign Het
Acacb T C 5: 114,351,712 (GRCm39) F1150L probably benign Het
Acat3 A G 17: 13,146,273 (GRCm39) Y237H possibly damaging Het
Arfgap3 T C 15: 83,206,869 (GRCm39) T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Cabin1 T C 10: 75,590,675 (GRCm39) S23G possibly damaging Het
Cemip2 G T 19: 21,819,479 (GRCm39) R1090L probably damaging Het
Clasp1 A G 1: 118,506,636 (GRCm39) N949S probably damaging Het
Csrp1 T G 1: 135,673,065 (GRCm39) C61G probably damaging Het
Dgka A T 10: 128,557,064 (GRCm39) L637Q probably damaging Het
Dst G A 1: 34,251,328 (GRCm39) R1801H probably damaging Het
Edil3 T C 13: 89,328,397 (GRCm39) S284P probably damaging Het
Eif2d A G 1: 131,082,100 (GRCm39) Y64C probably damaging Het
Ell2 A G 13: 75,910,067 (GRCm39) D139G probably damaging Het
Fam187a A G 11: 102,777,038 (GRCm39) R281G probably damaging Het
Gin1 A G 1: 97,720,145 (GRCm39) D380G possibly damaging Het
Gpr149 T G 3: 62,511,924 (GRCm39) D25A possibly damaging Het
Gyg1 A G 3: 20,206,901 (GRCm39) S90P probably benign Het
Hpx C T 7: 105,244,354 (GRCm39) M190I probably null Het
Irf2bpl C T 12: 86,929,810 (GRCm39) V288I probably benign Het
Lyst A G 13: 13,810,574 (GRCm39) H748R probably benign Het
Mmrn1 G A 6: 60,935,164 (GRCm39) G220D probably damaging Het
Mpdz A T 4: 81,299,999 (GRCm39) M333K probably benign Het
Muc5ac C T 7: 141,370,847 (GRCm39) S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Ntsr1 A G 2: 180,142,545 (GRCm39) D112G probably damaging Het
Or56b1 T A 7: 104,285,356 (GRCm39) N158K possibly damaging Het
Or7a42 T C 10: 78,791,117 (GRCm39) F26S probably benign Het
Or9s14 A C 1: 92,536,317 (GRCm39) T253P possibly damaging Het
Parg A G 14: 31,976,493 (GRCm39) K178R probably benign Het
Pde8b C A 13: 95,359,053 (GRCm39) C90F probably benign Het
Pld1 G A 3: 28,174,932 (GRCm39) V857I probably benign Het
Rad54l2 A C 9: 106,594,994 (GRCm39) V321G probably damaging Het
Rcn2 A G 9: 55,952,491 (GRCm39) Y112C possibly damaging Het
Rnf123 A T 9: 107,941,162 (GRCm39) D639E probably benign Het
Rufy2 C T 10: 62,840,551 (GRCm39) Q441* probably null Het
Scgb2b12 T C 7: 32,026,063 (GRCm39) Y43C probably damaging Het
Scrn3 T A 2: 73,149,845 (GRCm39) probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc22a8 T C 19: 8,585,597 (GRCm39) S321P probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tex2 A G 11: 106,458,398 (GRCm39) probably benign Het
Trip13 A G 13: 74,081,009 (GRCm39) I119T probably benign Het
Ttn A G 2: 76,602,911 (GRCm39) I16691T possibly damaging Het
Tyr A G 7: 87,078,276 (GRCm39) L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 (GRCm39) V142A probably damaging Het
Uggt2 C T 14: 119,286,674 (GRCm39) D221N probably damaging Het
Wnt4 A G 4: 137,023,654 (GRCm39) K207R possibly damaging Het
Zfp608 T C 18: 55,121,267 (GRCm39) R107G probably damaging Het
Other mutations in Tsku
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0034:Tsku UTSW 7 98,001,870 (GRCm39) missense possibly damaging 0.70
R0034:Tsku UTSW 7 98,001,870 (GRCm39) missense possibly damaging 0.70
R1560:Tsku UTSW 7 98,002,151 (GRCm39) missense probably damaging 1.00
R1745:Tsku UTSW 7 98,001,386 (GRCm39) missense possibly damaging 0.80
R1994:Tsku UTSW 7 98,001,353 (GRCm39) missense probably damaging 1.00
R2899:Tsku UTSW 7 98,002,124 (GRCm39) missense probably damaging 1.00
R3429:Tsku UTSW 7 98,001,746 (GRCm39) missense probably damaging 1.00
R3430:Tsku UTSW 7 98,001,746 (GRCm39) missense probably damaging 1.00
R4202:Tsku UTSW 7 98,002,205 (GRCm39) missense probably damaging 0.99
R4205:Tsku UTSW 7 98,002,205 (GRCm39) missense probably damaging 0.99
R4373:Tsku UTSW 7 98,002,038 (GRCm39) missense probably benign 0.01
R5782:Tsku UTSW 7 98,002,057 (GRCm39) missense probably damaging 0.99
R5818:Tsku UTSW 7 98,001,305 (GRCm39) missense possibly damaging 0.93
R8972:Tsku UTSW 7 98,001,704 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGGTGAGCAGGTTGTAAC -3'
(R):5'- GGTGACAAGTTCCAGCTGTGTC -3'

Sequencing Primer
(F):5'- TGAGCAGGTTGTAACTGAGATCC -3'
(R):5'- CTGTCTCTTATAGGCCAGGATGC -3'
Posted On 2015-06-10