Incidental Mutation 'R4206:Tsku'
ID318915
Institutional Source Beutler Lab
Gene Symbol Tsku
Ensembl Gene ENSMUSG00000049580
Gene Nametsukushi, small leucine rich proteoglycan
Synonyms9530051K01Rik, Lrrc54
MMRRC Submission 041035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4206 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location98350668-98361328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98352998 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 42 (R42H)
Ref Sequence ENSEMBL: ENSMUSP00000146025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094161] [ENSMUST00000164726] [ENSMUST00000165257] [ENSMUST00000165901] [ENSMUST00000167405] [ENSMUST00000179780] [ENSMUST00000206414]
Predicted Effect probably damaging
Transcript: ENSMUST00000094161
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091713
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164726
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130917
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165257
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128431
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165901
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127242
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167405
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131789
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179780
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137437
Gene: ENSMUSG00000049580
AA Change: R42H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 20 63 3.24e0 SMART
LRR 63 81 2.54e2 SMART
LRR 84 107 7.38e1 SMART
LRR_TYP 108 131 8.34e-3 SMART
LRR 134 154 3.18e2 SMART
LRR 203 228 2.76e1 SMART
LRR 254 278 4.09e1 SMART
LRR 279 302 1.71e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206414
AA Change: R42H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206770
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a failure of anterior commissure axons to cross the midline. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,473,515 K81R probably benign Het
Acacb T C 5: 114,213,651 F1150L probably benign Het
Acat3 A G 17: 12,927,386 Y237H possibly damaging Het
Arfgap3 T C 15: 83,322,668 T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cabin1 T C 10: 75,754,841 S23G possibly damaging Het
Clasp1 A G 1: 118,578,906 N949S probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dgka A T 10: 128,721,195 L637Q probably damaging Het
Dst G A 1: 34,212,247 R1801H probably damaging Het
Edil3 T C 13: 89,180,278 S284P probably damaging Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Ell2 A G 13: 75,761,948 D139G probably damaging Het
Fam187a A G 11: 102,886,212 R281G probably damaging Het
Gin1 A G 1: 97,792,420 D380G possibly damaging Het
Gpr149 T G 3: 62,604,503 D25A possibly damaging Het
Gyg A G 3: 20,152,737 S90P probably benign Het
Hpx C T 7: 105,595,147 M190I probably null Het
Irf2bpl C T 12: 86,883,036 V288I probably benign Het
Lyst A G 13: 13,635,989 H748R probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mpdz A T 4: 81,381,762 M333K probably benign Het
Muc5ac C T 7: 141,817,110 S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntsr1 A G 2: 180,500,752 D112G probably damaging Het
Olfr1410 A C 1: 92,608,595 T253P possibly damaging Het
Olfr657 T A 7: 104,636,149 N158K possibly damaging Het
Olfr8 T C 10: 78,955,283 F26S probably benign Het
Parg A G 14: 32,254,536 K178R probably benign Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pld1 G A 3: 28,120,783 V857I probably benign Het
Rad54l2 A C 9: 106,717,795 V321G probably damaging Het
Rcn2 A G 9: 56,045,207 Y112C possibly damaging Het
Rnf123 A T 9: 108,063,963 D639E probably benign Het
Rufy2 C T 10: 63,004,772 Q441* probably null Het
Scgb2b12 T C 7: 32,326,638 Y43C probably damaging Het
Scrn3 T A 2: 73,319,501 probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc22a8 T C 19: 8,608,233 S321P probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tex2 A G 11: 106,567,572 probably benign Het
Tmem2 G T 19: 21,842,115 R1090L probably damaging Het
Trip13 A G 13: 73,932,890 I119T probably benign Het
Ttn A G 2: 76,772,567 I16691T possibly damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 V142A probably damaging Het
Uggt2 C T 14: 119,049,262 D221N probably damaging Het
Wnt4 A G 4: 137,296,343 K207R possibly damaging Het
Zfp608 T C 18: 54,988,195 R107G probably damaging Het
Other mutations in Tsku
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0034:Tsku UTSW 7 98352663 missense possibly damaging 0.70
R0034:Tsku UTSW 7 98352663 missense possibly damaging 0.70
R1560:Tsku UTSW 7 98352944 missense probably damaging 1.00
R1745:Tsku UTSW 7 98352179 missense possibly damaging 0.80
R1994:Tsku UTSW 7 98352146 missense probably damaging 1.00
R2899:Tsku UTSW 7 98352917 missense probably damaging 1.00
R3429:Tsku UTSW 7 98352539 missense probably damaging 1.00
R3430:Tsku UTSW 7 98352539 missense probably damaging 1.00
R4202:Tsku UTSW 7 98352998 missense probably damaging 0.99
R4205:Tsku UTSW 7 98352998 missense probably damaging 0.99
R4373:Tsku UTSW 7 98352831 missense probably benign 0.01
R5782:Tsku UTSW 7 98352850 missense probably damaging 0.99
R5818:Tsku UTSW 7 98352098 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTGGTGAGCAGGTTGTAAC -3'
(R):5'- GGTGACAAGTTCCAGCTGTGTC -3'

Sequencing Primer
(F):5'- TGAGCAGGTTGTAACTGAGATCC -3'
(R):5'- CTGTCTCTTATAGGCCAGGATGC -3'
Posted On2015-06-10