Incidental Mutation 'R4206:Hpx'
ID 318917
Institutional Source Beutler Lab
Gene Symbol Hpx
Ensembl Gene ENSMUSG00000030895
Gene Name hemopexin
Synonyms Hpxn, hx
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4206 (G1)
Quality Score 216
Status Not validated
Chromosome 7
Chromosomal Location 105240818-105249323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105244354 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 190 (M190I)
Ref Sequence ENSEMBL: ENSMUSP00000147802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033185] [ENSMUST00000210531]
AlphaFold Q91X72
Predicted Effect probably benign
Transcript: ENSMUST00000033185
AA Change: M251I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033185
Gene: ENSMUSG00000030895
AA Change: M251I

DomainStartEndE-ValueType
HX 56 93 1.29e0 SMART
HX 97 140 5.52e-8 SMART
Blast:HX 143 186 3e-7 BLAST
HX 187 230 3.48e-5 SMART
HX 261 304 1.07e-5 SMART
HX 306 351 5.49e-3 SMART
Blast:HX 358 403 2e-17 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000210531
AA Change: M190I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However, they have increased susceptiblity to induced hemolytic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,315,435 (GRCm39) K81R probably benign Het
Acacb T C 5: 114,351,712 (GRCm39) F1150L probably benign Het
Acat3 A G 17: 13,146,273 (GRCm39) Y237H possibly damaging Het
Arfgap3 T C 15: 83,206,869 (GRCm39) T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Cabin1 T C 10: 75,590,675 (GRCm39) S23G possibly damaging Het
Cemip2 G T 19: 21,819,479 (GRCm39) R1090L probably damaging Het
Clasp1 A G 1: 118,506,636 (GRCm39) N949S probably damaging Het
Csrp1 T G 1: 135,673,065 (GRCm39) C61G probably damaging Het
Dgka A T 10: 128,557,064 (GRCm39) L637Q probably damaging Het
Dst G A 1: 34,251,328 (GRCm39) R1801H probably damaging Het
Edil3 T C 13: 89,328,397 (GRCm39) S284P probably damaging Het
Eif2d A G 1: 131,082,100 (GRCm39) Y64C probably damaging Het
Ell2 A G 13: 75,910,067 (GRCm39) D139G probably damaging Het
Fam187a A G 11: 102,777,038 (GRCm39) R281G probably damaging Het
Gin1 A G 1: 97,720,145 (GRCm39) D380G possibly damaging Het
Gpr149 T G 3: 62,511,924 (GRCm39) D25A possibly damaging Het
Gyg1 A G 3: 20,206,901 (GRCm39) S90P probably benign Het
Irf2bpl C T 12: 86,929,810 (GRCm39) V288I probably benign Het
Lyst A G 13: 13,810,574 (GRCm39) H748R probably benign Het
Mmrn1 G A 6: 60,935,164 (GRCm39) G220D probably damaging Het
Mpdz A T 4: 81,299,999 (GRCm39) M333K probably benign Het
Muc5ac C T 7: 141,370,847 (GRCm39) S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Ntsr1 A G 2: 180,142,545 (GRCm39) D112G probably damaging Het
Or56b1 T A 7: 104,285,356 (GRCm39) N158K possibly damaging Het
Or7a42 T C 10: 78,791,117 (GRCm39) F26S probably benign Het
Or9s14 A C 1: 92,536,317 (GRCm39) T253P possibly damaging Het
Parg A G 14: 31,976,493 (GRCm39) K178R probably benign Het
Pde8b C A 13: 95,359,053 (GRCm39) C90F probably benign Het
Pld1 G A 3: 28,174,932 (GRCm39) V857I probably benign Het
Rad54l2 A C 9: 106,594,994 (GRCm39) V321G probably damaging Het
Rcn2 A G 9: 55,952,491 (GRCm39) Y112C possibly damaging Het
Rnf123 A T 9: 107,941,162 (GRCm39) D639E probably benign Het
Rufy2 C T 10: 62,840,551 (GRCm39) Q441* probably null Het
Scgb2b12 T C 7: 32,026,063 (GRCm39) Y43C probably damaging Het
Scrn3 T A 2: 73,149,845 (GRCm39) probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc22a8 T C 19: 8,585,597 (GRCm39) S321P probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tex2 A G 11: 106,458,398 (GRCm39) probably benign Het
Trip13 A G 13: 74,081,009 (GRCm39) I119T probably benign Het
Tsku C T 7: 98,002,205 (GRCm39) R42H probably damaging Het
Ttn A G 2: 76,602,911 (GRCm39) I16691T possibly damaging Het
Tyr A G 7: 87,078,276 (GRCm39) L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 (GRCm39) V142A probably damaging Het
Uggt2 C T 14: 119,286,674 (GRCm39) D221N probably damaging Het
Wnt4 A G 4: 137,023,654 (GRCm39) K207R possibly damaging Het
Zfp608 T C 18: 55,121,267 (GRCm39) R107G probably damaging Het
Other mutations in Hpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Hpx APN 7 105,240,977 (GRCm39) missense probably damaging 1.00
IGL01861:Hpx APN 7 105,241,393 (GRCm39) nonsense probably null
IGL02441:Hpx APN 7 105,241,430 (GRCm39) missense probably damaging 1.00
IGL03117:Hpx APN 7 105,249,278 (GRCm39) missense possibly damaging 0.94
IGL03230:Hpx APN 7 105,248,519 (GRCm39) missense probably benign 0.04
IGL03376:Hpx APN 7 105,241,458 (GRCm39) unclassified probably benign
IGL03392:Hpx APN 7 105,241,609 (GRCm39) missense probably damaging 1.00
PIT4520001:Hpx UTSW 7 105,241,341 (GRCm39) missense probably benign 0.00
R0138:Hpx UTSW 7 105,241,445 (GRCm39) missense probably damaging 1.00
R0364:Hpx UTSW 7 105,245,471 (GRCm39) missense probably benign 0.18
R1195:Hpx UTSW 7 105,248,856 (GRCm39) splice site probably benign
R1195:Hpx UTSW 7 105,248,856 (GRCm39) splice site probably benign
R1958:Hpx UTSW 7 105,245,603 (GRCm39) missense probably damaging 1.00
R2007:Hpx UTSW 7 105,244,781 (GRCm39) missense probably damaging 1.00
R2025:Hpx UTSW 7 105,244,311 (GRCm39) missense probably damaging 1.00
R2173:Hpx UTSW 7 105,241,290 (GRCm39) missense probably benign 0.01
R2207:Hpx UTSW 7 105,241,633 (GRCm39) missense probably damaging 1.00
R3162:Hpx UTSW 7 105,248,847 (GRCm39) intron probably benign
R3849:Hpx UTSW 7 105,245,498 (GRCm39) missense probably damaging 1.00
R4510:Hpx UTSW 7 105,241,295 (GRCm39) missense possibly damaging 0.94
R4511:Hpx UTSW 7 105,241,295 (GRCm39) missense possibly damaging 0.94
R4709:Hpx UTSW 7 105,249,243 (GRCm39) missense probably benign 0.05
R5029:Hpx UTSW 7 105,240,971 (GRCm39) missense probably damaging 1.00
R5540:Hpx UTSW 7 105,241,119 (GRCm39) missense possibly damaging 0.67
R5631:Hpx UTSW 7 105,244,808 (GRCm39) missense probably damaging 0.96
R5664:Hpx UTSW 7 105,244,355 (GRCm39) missense probably benign 0.02
R5820:Hpx UTSW 7 105,240,995 (GRCm39) missense possibly damaging 0.89
R5922:Hpx UTSW 7 105,244,831 (GRCm39) missense probably damaging 1.00
R6707:Hpx UTSW 7 105,244,682 (GRCm39) missense probably benign 0.09
R6714:Hpx UTSW 7 105,244,302 (GRCm39) missense probably damaging 0.98
R7356:Hpx UTSW 7 105,240,917 (GRCm39) missense probably damaging 0.99
R7425:Hpx UTSW 7 105,241,068 (GRCm39) missense probably damaging 1.00
R8048:Hpx UTSW 7 105,244,685 (GRCm39) missense probably benign
R8184:Hpx UTSW 7 105,241,352 (GRCm39) missense probably damaging 0.99
X0066:Hpx UTSW 7 105,245,594 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGTTGGACTATGAACCTGAGG -3'
(R):5'- AGGAGAAGCCCACATTCCTC -3'

Sequencing Primer
(F):5'- TTGGACTATGAACCTGAGGAGATG -3'
(R):5'- CTCCTACCCAGTGTGTGTGTG -3'
Posted On 2015-06-10