Mutagenetix > Incidental Mutation

Incidental Mutation 'R4206:Hpx'

318917

Institutional Source

Beutler Lab

Gene Symbol

Hpx

Ensembl Gene

ENSMUSG00000030895

Gene Name

hemopexin

Synonyms

Hpxn, hx

MMRRC Submission

041035-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4206 (G1)

Quality Score

216

Status

Not validated

Chromosome

Chromosomal Location

105591613-105600137 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 105595147 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 190 (M190I)

Ref Sequence

ENSEMBL: ENSMUSP00000147802 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033185] [ENSMUST00000210531]

AlphaFold

Q91X72

Predicted Effect

probably benign
Transcript: ENSMUST00000033185
AA Change: M251I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000033185
Gene: ENSMUSG00000030895
AA Change: M251I

Domain	Start	End	E-Value	Type
HX	56	93	1.29e0	SMART
HX	97	140	5.52e-8	SMART
Blast:HX	143	186	3e-7	BLAST
HX	187	230	3.48e-5	SMART
HX	261	304	1.07e-5	SMART
HX	306	351	5.49e-3	SMART
Blast:HX	358	403	2e-17	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000210531
AA Change: M190I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However, they have increased susceptiblity to induced hemolytic stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,473,515	K81R	probably benign	Het
Acacb	T	C	5: 114,213,651	F1150L	probably benign	Het
Acat3	A	G	17: 12,927,386	Y237H	possibly damaging	Het
Arfgap3	T	C	15: 83,322,668	T240A	probably benign	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Cabin1	T	C	10: 75,754,841	S23G	possibly damaging	Het
Clasp1	A	G	1: 118,578,906	N949S	probably damaging	Het
Csrp1	T	G	1: 135,745,327	C61G	probably damaging	Het
Dgka	A	T	10: 128,721,195	L637Q	probably damaging	Het
Dst	G	A	1: 34,212,247	R1801H	probably damaging	Het
Edil3	T	C	13: 89,180,278	S284P	probably damaging	Het
Eif2d	A	G	1: 131,154,363	Y64C	probably damaging	Het
Ell2	A	G	13: 75,761,948	D139G	probably damaging	Het
Fam187a	A	G	11: 102,886,212	R281G	probably damaging	Het
Gin1	A	G	1: 97,792,420	D380G	possibly damaging	Het
Gpr149	T	G	3: 62,604,503	D25A	possibly damaging	Het
Gyg	A	G	3: 20,152,737	S90P	probably benign	Het
Irf2bpl	C	T	12: 86,883,036	V288I	probably benign	Het
Lyst	A	G	13: 13,635,989	H748R	probably benign	Het
Mmrn1	G	A	6: 60,958,180	G220D	probably damaging	Het
Mpdz	A	T	4: 81,381,762	M333K	probably benign	Het
Muc5ac	C	T	7: 141,817,110	S2556F	possibly damaging	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Ntsr1	A	G	2: 180,500,752	D112G	probably damaging	Het
Olfr1410	A	C	1: 92,608,595	T253P	possibly damaging	Het
Olfr657	T	A	7: 104,636,149	N158K	possibly damaging	Het
Olfr8	T	C	10: 78,955,283	F26S	probably benign	Het
Parg	A	G	14: 32,254,536	K178R	probably benign	Het
Pde8b	C	A	13: 95,222,545	C90F	probably benign	Het
Pld1	G	A	3: 28,120,783	V857I	probably benign	Het
Rad54l2	A	C	9: 106,717,795	V321G	probably damaging	Het
Rcn2	A	G	9: 56,045,207	Y112C	possibly damaging	Het
Rnf123	A	T	9: 108,063,963	D639E	probably benign	Het
Rufy2	C	T	10: 63,004,772	Q441*	probably null	Het
Scgb2b12	T	C	7: 32,326,638	Y43C	probably damaging	Het
Scrn3	T	A	2: 73,319,501		probably null	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc22a8	T	C	19: 8,608,233	S321P	probably benign	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tex2	A	G	11: 106,567,572		probably benign	Het
Tmem2	G	T	19: 21,842,115	R1090L	probably damaging	Het
Trip13	A	G	13: 73,932,890	I119T	probably benign	Het
Tsku	C	T	7: 98,352,998	R42H	probably damaging	Het
Ttn	A	G	2: 76,772,567	I16691T	possibly damaging	Het
Tyr	A	G	7: 87,429,068	L528P	possibly damaging	Het
Ubxn2b	T	C	4: 6,204,565	V142A	probably damaging	Het
Uggt2	C	T	14: 119,049,262	D221N	probably damaging	Het
Wnt4	A	G	4: 137,296,343	K207R	possibly damaging	Het
Zfp608	T	C	18: 54,988,195	R107G	probably damaging	Het

Other mutations in Hpx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Hpx	APN	7	105591770	missense	probably damaging	1.00
IGL01861:Hpx	APN	7	105592186	nonsense	probably null
IGL02441:Hpx	APN	7	105592223	missense	probably damaging	1.00
IGL03117:Hpx	APN	7	105600071	missense	possibly damaging	0.94
IGL03230:Hpx	APN	7	105599312	missense	probably benign	0.04
IGL03376:Hpx	APN	7	105592251	unclassified	probably benign
IGL03392:Hpx	APN	7	105592402	missense	probably damaging	1.00
PIT4520001:Hpx	UTSW	7	105592134	missense	probably benign	0.00
R0138:Hpx	UTSW	7	105592238	missense	probably damaging	1.00
R0364:Hpx	UTSW	7	105596264	missense	probably benign	0.18
R1195:Hpx	UTSW	7	105599649	splice site	probably benign
R1195:Hpx	UTSW	7	105599649	splice site	probably benign
R1958:Hpx	UTSW	7	105596396	missense	probably damaging	1.00
R2007:Hpx	UTSW	7	105595574	missense	probably damaging	1.00
R2025:Hpx	UTSW	7	105595104	missense	probably damaging	1.00
R2173:Hpx	UTSW	7	105592083	missense	probably benign	0.01
R2207:Hpx	UTSW	7	105592426	missense	probably damaging	1.00
R3162:Hpx	UTSW	7	105599640	intron	probably benign
R3849:Hpx	UTSW	7	105596291	missense	probably damaging	1.00
R4510:Hpx	UTSW	7	105592088	missense	possibly damaging	0.94
R4511:Hpx	UTSW	7	105592088	missense	possibly damaging	0.94
R4709:Hpx	UTSW	7	105600036	missense	probably benign	0.05
R5029:Hpx	UTSW	7	105591764	missense	probably damaging	1.00
R5540:Hpx	UTSW	7	105591912	missense	possibly damaging	0.67
R5631:Hpx	UTSW	7	105595601	missense	probably damaging	0.96
R5664:Hpx	UTSW	7	105595148	missense	probably benign	0.02
R5820:Hpx	UTSW	7	105591788	missense	possibly damaging	0.89
R5922:Hpx	UTSW	7	105595624	missense	probably damaging	1.00
R6707:Hpx	UTSW	7	105595475	missense	probably benign	0.09
R6714:Hpx	UTSW	7	105595095	missense	probably damaging	0.98
R7356:Hpx	UTSW	7	105591710	missense	probably damaging	0.99
R7425:Hpx	UTSW	7	105591861	missense	probably damaging	1.00
R8048:Hpx	UTSW	7	105595478	missense	probably benign
R8184:Hpx	UTSW	7	105592145	missense	probably damaging	0.99
X0066:Hpx	UTSW	7	105596387	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GGTTGGACTATGAACCTGAGG -3'
(R):5'- AGGAGAAGCCCACATTCCTC -3'

Sequencing Primer
(F):5'- TTGGACTATGAACCTGAGGAGATG -3'
(R):5'- CTCCTACCCAGTGTGTGTGTG -3'

Posted On

2015-06-10