Mutagenetix > Incidental Mutation

Incidental Mutation 'R4206:Nfix'

318919

Institutional Source

Beutler Lab

Gene Symbol

Nfix

Ensembl Gene

ENSMUSG00000001911

Gene Name

nuclear factor I/X

Synonyms

MMRRC Submission

041035-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.496) question?

Stock #

R4206 (G1)

Quality Score

108

Status

Not validated

Chromosome

Chromosomal Location

84699876-84800344 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CAAAAA to CAAAA at 84716247 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000076715

SMART Domains

Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.1e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	322	7.4e-32	PFAM
Pfam:CTF_NFI	313	396	3.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099070

SMART Domains

Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.7e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	437	2.7e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109762

SMART Domains

Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1.1e-27	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	312	5.4e-32	PFAM
Pfam:CTF_NFI	305	387	3.6e-19	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000109764

SMART Domains

Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1e-28	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	494	9.8e-137	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000126806

SMART Domains

Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	7.1e-31	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	488	1.5e-83	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132236

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,473,515	K81R	probably benign	Het
Acacb	T	C	5: 114,213,651	F1150L	probably benign	Het
Acat3	A	G	17: 12,927,386	Y237H	possibly damaging	Het
Arfgap3	T	C	15: 83,322,668	T240A	probably benign	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Cabin1	T	C	10: 75,754,841	S23G	possibly damaging	Het
Clasp1	A	G	1: 118,578,906	N949S	probably damaging	Het
Csrp1	T	G	1: 135,745,327	C61G	probably damaging	Het
Dgka	A	T	10: 128,721,195	L637Q	probably damaging	Het
Dst	G	A	1: 34,212,247	R1801H	probably damaging	Het
Edil3	T	C	13: 89,180,278	S284P	probably damaging	Het
Eif2d	A	G	1: 131,154,363	Y64C	probably damaging	Het
Ell2	A	G	13: 75,761,948	D139G	probably damaging	Het
Fam187a	A	G	11: 102,886,212	R281G	probably damaging	Het
Gin1	A	G	1: 97,792,420	D380G	possibly damaging	Het
Gpr149	T	G	3: 62,604,503	D25A	possibly damaging	Het
Gyg	A	G	3: 20,152,737	S90P	probably benign	Het
Hpx	C	T	7: 105,595,147	M190I	probably null	Het
Irf2bpl	C	T	12: 86,883,036	V288I	probably benign	Het
Lyst	A	G	13: 13,635,989	H748R	probably benign	Het
Mmrn1	G	A	6: 60,958,180	G220D	probably damaging	Het
Mpdz	A	T	4: 81,381,762	M333K	probably benign	Het
Muc5ac	C	T	7: 141,817,110	S2556F	possibly damaging	Het
Ntsr1	A	G	2: 180,500,752	D112G	probably damaging	Het
Olfr1410	A	C	1: 92,608,595	T253P	possibly damaging	Het
Olfr657	T	A	7: 104,636,149	N158K	possibly damaging	Het
Olfr8	T	C	10: 78,955,283	F26S	probably benign	Het
Parg	A	G	14: 32,254,536	K178R	probably benign	Het
Pde8b	C	A	13: 95,222,545	C90F	probably benign	Het
Pld1	G	A	3: 28,120,783	V857I	probably benign	Het
Rad54l2	A	C	9: 106,717,795	V321G	probably damaging	Het
Rcn2	A	G	9: 56,045,207	Y112C	possibly damaging	Het
Rnf123	A	T	9: 108,063,963	D639E	probably benign	Het
Rufy2	C	T	10: 63,004,772	Q441*	probably null	Het
Scgb2b12	T	C	7: 32,326,638	Y43C	probably damaging	Het
Scrn3	T	A	2: 73,319,501		probably null	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc22a8	T	C	19: 8,608,233	S321P	probably benign	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tex2	A	G	11: 106,567,572		probably benign	Het
Tmem2	G	T	19: 21,842,115	R1090L	probably damaging	Het
Trip13	A	G	13: 73,932,890	I119T	probably benign	Het
Tsku	C	T	7: 98,352,998	R42H	probably damaging	Het
Ttn	A	G	2: 76,772,567	I16691T	possibly damaging	Het
Tyr	A	G	7: 87,429,068	L528P	possibly damaging	Het
Ubxn2b	T	C	4: 6,204,565	V142A	probably damaging	Het
Uggt2	C	T	14: 119,049,262	D221N	probably damaging	Het
Wnt4	A	G	4: 137,296,343	K207R	possibly damaging	Het
Zfp608	T	C	18: 54,988,195	R107G	probably damaging	Het

Other mutations in Nfix

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Nfix	APN	8	84726477	missense	probably damaging	0.99
IGL01919:Nfix	APN	8	84726474	missense	probably damaging	1.00
IGL01950:Nfix	APN	8	84713786	makesense	probably null
IGL02862:Nfix	APN	8	84713846	missense	probably benign	0.07
R0142:Nfix	UTSW	8	84721686	missense	probably damaging	1.00
R0309:Nfix	UTSW	8	84721774	missense	probably damaging	1.00
R0600:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0622:Nfix	UTSW	8	84726482	missense	probably damaging	0.99
R0628:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0882:Nfix	UTSW	8	84727925	missense	probably damaging	1.00
R0893:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0974:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0975:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1014:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1015:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1162:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1241:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1381:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1513:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1521:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1618:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1865:Nfix	UTSW	8	84772275	missense	possibly damaging	0.73
R1912:Nfix	UTSW	8	84721677	missense	probably damaging	1.00
R1974:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R2208:Nfix	UTSW	8	84716247	frame shift	probably null
R2251:Nfix	UTSW	8	84716170	missense	probably benign	0.03
R2268:Nfix	UTSW	8	84716247	frame shift	probably null
R2270:Nfix	UTSW	8	84716247	frame shift	probably null
R2272:Nfix	UTSW	8	84727175	missense	probably damaging	1.00
R2346:Nfix	UTSW	8	84716247	frame shift	probably null
R2350:Nfix	UTSW	8	84716247	frame shift	probably null
R2963:Nfix	UTSW	8	84716247	frame shift	probably null
R2983:Nfix	UTSW	8	84716247	frame shift	probably null
R3008:Nfix	UTSW	8	84716247	frame shift	probably null
R3727:Nfix	UTSW	8	84716247	frame shift	probably null
R3791:Nfix	UTSW	8	84716247	frame shift	probably null
R4163:Nfix	UTSW	8	84716247	frame shift	probably null
R4164:Nfix	UTSW	8	84716247	frame shift	probably null
R4201:Nfix	UTSW	8	84716247	frame shift	probably null
R4609:Nfix	UTSW	8	84726490	missense	probably damaging	1.00
R4801:Nfix	UTSW	8	84716247	frame shift	probably null
R4802:Nfix	UTSW	8	84716247	frame shift	probably null
R4914:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4915:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4916:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4918:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R5013:Nfix	UTSW	8	84772084	missense	possibly damaging	0.86
R5290:Nfix	UTSW	8	84713777	nonsense	probably null
R6418:Nfix	UTSW	8	84727149	missense	probably benign	0.01
R6554:Nfix	UTSW	8	84727650	missense	possibly damaging	0.93
R6786:Nfix	UTSW	8	84727647	missense	probably damaging	1.00
R8853:Nfix	UTSW	8	84727647	missense	probably damaging	1.00
R9014:Nfix	UTSW	8	84721776	missense	possibly damaging	0.95
T0970:Nfix	UTSW	8	84726483	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCTGGCTGGAGTAACTGAG -3'
(R):5'- TCCTGTGCCTAGAGGAAAGG -3'

Sequencing Primer
(F):5'- CCTCTCTTTGCAGTGGAGAC -3'
(R):5'- GAGGAAAGGACCCTCCCTC -3'

Posted On

2015-06-10