Incidental Mutation 'R4206:Rad54l2'
ID318922
Institutional Source Beutler Lab
Gene Symbol Rad54l2
Ensembl Gene ENSMUSG00000040661
Gene NameRAD54 like 2 (S. cerevisiae)
SynonymsSrisnf2l, G630026H09Rik, Arip4
MMRRC Submission 041035-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4206 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location106688082-106789194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 106717795 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 321 (V321G)
Ref Sequence ENSEMBL: ENSMUSP00000045454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046502]
Predicted Effect probably damaging
Transcript: ENSMUST00000046502
AA Change: V321G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: V321G

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 130 146 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 215 229 N/A INTRINSIC
DEXDc 267 520 4.21e-20 SMART
HELICc 751 854 1.88e-17 SMART
low complexity region 959 976 N/A INTRINSIC
low complexity region 1348 1368 N/A INTRINSIC
low complexity region 1453 1460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190363
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,473,515 K81R probably benign Het
Acacb T C 5: 114,213,651 F1150L probably benign Het
Acat3 A G 17: 12,927,386 Y237H possibly damaging Het
Arfgap3 T C 15: 83,322,668 T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cabin1 T C 10: 75,754,841 S23G possibly damaging Het
Clasp1 A G 1: 118,578,906 N949S probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dgka A T 10: 128,721,195 L637Q probably damaging Het
Dst G A 1: 34,212,247 R1801H probably damaging Het
Edil3 T C 13: 89,180,278 S284P probably damaging Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Ell2 A G 13: 75,761,948 D139G probably damaging Het
Fam187a A G 11: 102,886,212 R281G probably damaging Het
Gin1 A G 1: 97,792,420 D380G possibly damaging Het
Gpr149 T G 3: 62,604,503 D25A possibly damaging Het
Gyg A G 3: 20,152,737 S90P probably benign Het
Hpx C T 7: 105,595,147 M190I probably null Het
Irf2bpl C T 12: 86,883,036 V288I probably benign Het
Lyst A G 13: 13,635,989 H748R probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mpdz A T 4: 81,381,762 M333K probably benign Het
Muc5ac C T 7: 141,817,110 S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntsr1 A G 2: 180,500,752 D112G probably damaging Het
Olfr1410 A C 1: 92,608,595 T253P possibly damaging Het
Olfr657 T A 7: 104,636,149 N158K possibly damaging Het
Olfr8 T C 10: 78,955,283 F26S probably benign Het
Parg A G 14: 32,254,536 K178R probably benign Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pld1 G A 3: 28,120,783 V857I probably benign Het
Rcn2 A G 9: 56,045,207 Y112C possibly damaging Het
Rnf123 A T 9: 108,063,963 D639E probably benign Het
Rufy2 C T 10: 63,004,772 Q441* probably null Het
Scgb2b12 T C 7: 32,326,638 Y43C probably damaging Het
Scrn3 T A 2: 73,319,501 probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc22a8 T C 19: 8,608,233 S321P probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tex2 A G 11: 106,567,572 probably benign Het
Tmem2 G T 19: 21,842,115 R1090L probably damaging Het
Trip13 A G 13: 73,932,890 I119T probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Ttn A G 2: 76,772,567 I16691T possibly damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 V142A probably damaging Het
Uggt2 C T 14: 119,049,262 D221N probably damaging Het
Wnt4 A G 4: 137,296,343 K207R possibly damaging Het
Zfp608 T C 18: 54,988,195 R107G probably damaging Het
Other mutations in Rad54l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Rad54l2 APN 9 106700561 missense probably benign
IGL00718:Rad54l2 APN 9 106713455 missense probably damaging 1.00
IGL00917:Rad54l2 APN 9 106710439 missense possibly damaging 0.95
IGL01319:Rad54l2 APN 9 106719046 missense probably benign 0.18
IGL01447:Rad54l2 APN 9 106702772 missense probably damaging 1.00
IGL01469:Rad54l2 APN 9 106722758 missense probably damaging 1.00
IGL01836:Rad54l2 APN 9 106716157 missense probably benign 0.00
IGL02017:Rad54l2 APN 9 106754040 missense possibly damaging 0.85
IGL02179:Rad54l2 APN 9 106720390 missense probably damaging 1.00
IGL02348:Rad54l2 APN 9 106720376 missense probably damaging 1.00
IGL02822:Rad54l2 APN 9 106710407 missense probably damaging 1.00
IGL03169:Rad54l2 APN 9 106719064 missense probably benign 0.37
IGL03245:Rad54l2 APN 9 106703628 missense probably damaging 1.00
IGL03253:Rad54l2 APN 9 106704223 missense probably damaging 1.00
IGL02988:Rad54l2 UTSW 9 106700585 missense probably benign
PIT4495001:Rad54l2 UTSW 9 106716144 missense probably benign 0.02
R0001:Rad54l2 UTSW 9 106708217 missense probably damaging 0.97
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0114:Rad54l2 UTSW 9 106713455 missense probably damaging 1.00
R0427:Rad54l2 UTSW 9 106693692 missense possibly damaging 0.65
R0519:Rad54l2 UTSW 9 106708299 missense probably damaging 0.98
R0760:Rad54l2 UTSW 9 106719606 critical splice donor site probably null
R1018:Rad54l2 UTSW 9 106712390 missense probably benign 0.32
R1630:Rad54l2 UTSW 9 106703629 missense possibly damaging 0.79
R1701:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R1903:Rad54l2 UTSW 9 106693717 splice site probably null
R2187:Rad54l2 UTSW 9 106753992 small deletion probably benign
R2205:Rad54l2 UTSW 9 106717798 missense probably damaging 1.00
R2566:Rad54l2 UTSW 9 106703626 missense possibly damaging 0.95
R2983:Rad54l2 UTSW 9 106700590 missense probably benign 0.10
R3176:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3276:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3718:Rad54l2 UTSW 9 106693527 missense probably benign
R4063:Rad54l2 UTSW 9 106720414 missense probably benign 0.10
R4271:Rad54l2 UTSW 9 106693626 missense probably benign 0.22
R4377:Rad54l2 UTSW 9 106693222 missense probably benign 0.00
R4700:Rad54l2 UTSW 9 106754025 missense possibly damaging 0.85
R4729:Rad54l2 UTSW 9 106716118 missense probably benign
R4872:Rad54l2 UTSW 9 106717892 missense probably damaging 1.00
R4997:Rad54l2 UTSW 9 106722909 missense possibly damaging 0.70
R5475:Rad54l2 UTSW 9 106705858 missense probably damaging 1.00
R5658:Rad54l2 UTSW 9 106753992 small deletion probably benign
R6246:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R6248:Rad54l2 UTSW 9 106710338 missense probably damaging 1.00
R6329:Rad54l2 UTSW 9 106717922 missense possibly damaging 0.89
R6631:Rad54l2 UTSW 9 106713540 nonsense probably null
R6773:Rad54l2 UTSW 9 106693317 missense probably benign
R7148:Rad54l2 UTSW 9 106719119 nonsense probably null
R7171:Rad54l2 UTSW 9 106713478 missense probably damaging 1.00
R7226:Rad54l2 UTSW 9 106713472 missense probably damaging 0.99
R7327:Rad54l2 UTSW 9 106693461 missense possibly damaging 0.68
R7337:Rad54l2 UTSW 9 106705825 missense probably damaging 1.00
R7636:Rad54l2 UTSW 9 106720387 missense probably damaging 1.00
R7659:Rad54l2 UTSW 9 106713578 missense probably benign 0.11
R7713:Rad54l2 UTSW 9 106717223 missense probably damaging 1.00
R7748:Rad54l2 UTSW 9 106719034 missense possibly damaging 0.53
R8021:Rad54l2 UTSW 9 106719641 missense probably benign 0.00
R8084:Rad54l2 UTSW 9 106713502 missense possibly damaging 0.63
R8552:Rad54l2 UTSW 9 106693578 missense possibly damaging 0.77
R8768:Rad54l2 UTSW 9 106719610 missense probably benign 0.04
R8952:Rad54l2 UTSW 9 106688851 unclassified probably benign
R8953:Rad54l2 UTSW 9 106693262 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTTCACCTAGGACAAGCCC -3'
(R):5'- AGCCCTGATCTCTGGTAGTG -3'

Sequencing Primer
(F):5'- GCCAGGCTTGAATTCAGGTCATC -3'
(R):5'- CCTGATCTCTGGTAGTGTTTCTGAC -3'
Posted On2015-06-10