Incidental Mutation 'R4206:Rufy2'
ID 318924
Institutional Source Beutler Lab
Gene Symbol Rufy2
Ensembl Gene ENSMUSG00000020070
Gene Name RUN and FYVE domain-containing 2
Synonyms ZFYVE13, 2610111M19Rik, LZ-FYVE, Denn
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4206 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 62816002-62852989 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 62840551 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 441 (Q441*)
Ref Sequence ENSEMBL: ENSMUSP00000113429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062600] [ENSMUST00000119567] [ENSMUST00000122231] [ENSMUST00000131718] [ENSMUST00000143594]
AlphaFold Q8R4C2
Predicted Effect probably benign
Transcript: ENSMUST00000062600
SMART Domains Protein: ENSMUSP00000059982
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119567
AA Change: Q441*
SMART Domains Protein: ENSMUSP00000113429
Gene: ENSMUSG00000020070
AA Change: Q441*

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 515 N/A INTRINSIC
FYVE 532 599 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122231
SMART Domains Protein: ENSMUSP00000113754
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
Pfam:RUN 45 100 6.2e-9 PFAM
low complexity region 110 123 N/A INTRINSIC
coiled coil region 176 234 N/A INTRINSIC
coiled coil region 292 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131718
SMART Domains Protein: ENSMUSP00000121419
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143594
SMART Domains Protein: ENSMUSP00000115339
Gene: ENSMUSG00000020070

DomainStartEndE-ValueType
RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143726
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,315,435 (GRCm39) K81R probably benign Het
Acacb T C 5: 114,351,712 (GRCm39) F1150L probably benign Het
Acat3 A G 17: 13,146,273 (GRCm39) Y237H possibly damaging Het
Arfgap3 T C 15: 83,206,869 (GRCm39) T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Cabin1 T C 10: 75,590,675 (GRCm39) S23G possibly damaging Het
Cemip2 G T 19: 21,819,479 (GRCm39) R1090L probably damaging Het
Clasp1 A G 1: 118,506,636 (GRCm39) N949S probably damaging Het
Csrp1 T G 1: 135,673,065 (GRCm39) C61G probably damaging Het
Dgka A T 10: 128,557,064 (GRCm39) L637Q probably damaging Het
Dst G A 1: 34,251,328 (GRCm39) R1801H probably damaging Het
Edil3 T C 13: 89,328,397 (GRCm39) S284P probably damaging Het
Eif2d A G 1: 131,082,100 (GRCm39) Y64C probably damaging Het
Ell2 A G 13: 75,910,067 (GRCm39) D139G probably damaging Het
Fam187a A G 11: 102,777,038 (GRCm39) R281G probably damaging Het
Gin1 A G 1: 97,720,145 (GRCm39) D380G possibly damaging Het
Gpr149 T G 3: 62,511,924 (GRCm39) D25A possibly damaging Het
Gyg1 A G 3: 20,206,901 (GRCm39) S90P probably benign Het
Hpx C T 7: 105,244,354 (GRCm39) M190I probably null Het
Irf2bpl C T 12: 86,929,810 (GRCm39) V288I probably benign Het
Lyst A G 13: 13,810,574 (GRCm39) H748R probably benign Het
Mmrn1 G A 6: 60,935,164 (GRCm39) G220D probably damaging Het
Mpdz A T 4: 81,299,999 (GRCm39) M333K probably benign Het
Muc5ac C T 7: 141,370,847 (GRCm39) S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Ntsr1 A G 2: 180,142,545 (GRCm39) D112G probably damaging Het
Or56b1 T A 7: 104,285,356 (GRCm39) N158K possibly damaging Het
Or7a42 T C 10: 78,791,117 (GRCm39) F26S probably benign Het
Or9s14 A C 1: 92,536,317 (GRCm39) T253P possibly damaging Het
Parg A G 14: 31,976,493 (GRCm39) K178R probably benign Het
Pde8b C A 13: 95,359,053 (GRCm39) C90F probably benign Het
Pld1 G A 3: 28,174,932 (GRCm39) V857I probably benign Het
Rad54l2 A C 9: 106,594,994 (GRCm39) V321G probably damaging Het
Rcn2 A G 9: 55,952,491 (GRCm39) Y112C possibly damaging Het
Rnf123 A T 9: 107,941,162 (GRCm39) D639E probably benign Het
Scgb2b12 T C 7: 32,026,063 (GRCm39) Y43C probably damaging Het
Scrn3 T A 2: 73,149,845 (GRCm39) probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc22a8 T C 19: 8,585,597 (GRCm39) S321P probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tex2 A G 11: 106,458,398 (GRCm39) probably benign Het
Trip13 A G 13: 74,081,009 (GRCm39) I119T probably benign Het
Tsku C T 7: 98,002,205 (GRCm39) R42H probably damaging Het
Ttn A G 2: 76,602,911 (GRCm39) I16691T possibly damaging Het
Tyr A G 7: 87,078,276 (GRCm39) L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 (GRCm39) V142A probably damaging Het
Uggt2 C T 14: 119,286,674 (GRCm39) D221N probably damaging Het
Wnt4 A G 4: 137,023,654 (GRCm39) K207R possibly damaging Het
Zfp608 T C 18: 55,121,267 (GRCm39) R107G probably damaging Het
Other mutations in Rufy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Rufy2 APN 10 62,826,833 (GRCm39) missense probably damaging 0.98
IGL01516:Rufy2 APN 10 62,847,212 (GRCm39) missense possibly damaging 0.82
IGL02811:Rufy2 APN 10 62,836,106 (GRCm39) missense probably damaging 1.00
IGL03244:Rufy2 APN 10 62,840,483 (GRCm39) missense probably benign 0.08
PIT4434001:Rufy2 UTSW 10 62,826,845 (GRCm39) missense possibly damaging 0.60
R0071:Rufy2 UTSW 10 62,824,946 (GRCm39) missense possibly damaging 0.95
R0448:Rufy2 UTSW 10 62,840,515 (GRCm39) missense probably benign
R0496:Rufy2 UTSW 10 62,828,949 (GRCm39) missense probably damaging 1.00
R0723:Rufy2 UTSW 10 62,833,873 (GRCm39) missense probably benign 0.43
R0731:Rufy2 UTSW 10 62,847,623 (GRCm39) critical splice donor site probably benign
R1236:Rufy2 UTSW 10 62,830,549 (GRCm39) missense probably benign 0.36
R1414:Rufy2 UTSW 10 62,837,978 (GRCm39) nonsense probably null
R1600:Rufy2 UTSW 10 62,842,450 (GRCm39) missense probably benign 0.00
R1626:Rufy2 UTSW 10 62,831,151 (GRCm39) missense probably benign 0.43
R2035:Rufy2 UTSW 10 62,842,526 (GRCm39) missense probably damaging 0.99
R2141:Rufy2 UTSW 10 62,826,773 (GRCm39) missense probably damaging 1.00
R2962:Rufy2 UTSW 10 62,836,039 (GRCm39) missense probably damaging 0.96
R3874:Rufy2 UTSW 10 62,833,916 (GRCm39) missense probably damaging 1.00
R4321:Rufy2 UTSW 10 62,818,459 (GRCm39) missense probably damaging 1.00
R4878:Rufy2 UTSW 10 62,837,990 (GRCm39) missense probably damaging 1.00
R5636:Rufy2 UTSW 10 62,833,733 (GRCm39) missense probably damaging 1.00
R7382:Rufy2 UTSW 10 62,833,748 (GRCm39) missense probably benign 0.04
R7714:Rufy2 UTSW 10 62,838,772 (GRCm39) missense probably benign 0.01
R8278:Rufy2 UTSW 10 62,843,472 (GRCm39) missense probably benign 0.27
R8777:Rufy2 UTSW 10 62,833,660 (GRCm39) missense possibly damaging 0.86
R8777-TAIL:Rufy2 UTSW 10 62,833,660 (GRCm39) missense possibly damaging 0.86
R9181:Rufy2 UTSW 10 62,836,166 (GRCm39) missense possibly damaging 0.94
R9756:Rufy2 UTSW 10 62,818,519 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCCTAGTTCTAGCCTCAG -3'
(R):5'- GGCTCAGCAGTTACGAGATACAC -3'

Sequencing Primer
(F):5'- AGCCTCAGTTTTACCCAAAGTTG -3'
(R):5'- CTTAAGCCAGGCATGATGGTACTC -3'
Posted On 2015-06-10