Incidental Mutation 'R4206:Olfr8'
ID318926
Institutional Source Beutler Lab
Gene Symbol Olfr8
Ensembl Gene ENSMUSG00000094080
Gene Nameolfactory receptor 8
SynonymsMOR139-5P, GA_x6K02T2QGN0-2857086-2856154
MMRRC Submission 041035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R4206 (G1)
Quality Score216
Status Not validated
Chromosome10
Chromosomal Location78950636-78958378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78955283 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 26 (F26S)
Ref Sequence ENSEMBL: ENSMUSP00000148856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081571] [ENSMUST00000203851] [ENSMUST00000214952]
Predicted Effect probably benign
Transcript: ENSMUST00000081571
AA Change: F26S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080282
Gene: ENSMUSG00000094080
AA Change: F26S

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203851
AA Change: F26S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144916
Gene: ENSMUSG00000094080
AA Change: F26S

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214952
AA Change: F26S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216819
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,473,515 K81R probably benign Het
Acacb T C 5: 114,213,651 F1150L probably benign Het
Acat3 A G 17: 12,927,386 Y237H possibly damaging Het
Arfgap3 T C 15: 83,322,668 T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cabin1 T C 10: 75,754,841 S23G possibly damaging Het
Clasp1 A G 1: 118,578,906 N949S probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dgka A T 10: 128,721,195 L637Q probably damaging Het
Dst G A 1: 34,212,247 R1801H probably damaging Het
Edil3 T C 13: 89,180,278 S284P probably damaging Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Ell2 A G 13: 75,761,948 D139G probably damaging Het
Fam187a A G 11: 102,886,212 R281G probably damaging Het
Gin1 A G 1: 97,792,420 D380G possibly damaging Het
Gpr149 T G 3: 62,604,503 D25A possibly damaging Het
Gyg A G 3: 20,152,737 S90P probably benign Het
Hpx C T 7: 105,595,147 M190I probably null Het
Irf2bpl C T 12: 86,883,036 V288I probably benign Het
Lyst A G 13: 13,635,989 H748R probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mpdz A T 4: 81,381,762 M333K probably benign Het
Muc5ac C T 7: 141,817,110 S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntsr1 A G 2: 180,500,752 D112G probably damaging Het
Olfr1410 A C 1: 92,608,595 T253P possibly damaging Het
Olfr657 T A 7: 104,636,149 N158K possibly damaging Het
Parg A G 14: 32,254,536 K178R probably benign Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pld1 G A 3: 28,120,783 V857I probably benign Het
Rad54l2 A C 9: 106,717,795 V321G probably damaging Het
Rcn2 A G 9: 56,045,207 Y112C possibly damaging Het
Rnf123 A T 9: 108,063,963 D639E probably benign Het
Rufy2 C T 10: 63,004,772 Q441* probably null Het
Scgb2b12 T C 7: 32,326,638 Y43C probably damaging Het
Scrn3 T A 2: 73,319,501 probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc22a8 T C 19: 8,608,233 S321P probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tex2 A G 11: 106,567,572 probably benign Het
Tmem2 G T 19: 21,842,115 R1090L probably damaging Het
Trip13 A G 13: 73,932,890 I119T probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Ttn A G 2: 76,772,567 I16691T possibly damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 V142A probably damaging Het
Uggt2 C T 14: 119,049,262 D221N probably damaging Het
Wnt4 A G 4: 137,296,343 K207R possibly damaging Het
Zfp608 T C 18: 54,988,195 R107G probably damaging Het
Other mutations in Olfr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Olfr8 APN 10 78955354 missense possibly damaging 0.48
IGL01480:Olfr8 APN 10 78956144 utr 3 prime probably benign
IGL02505:Olfr8 APN 10 78955933 missense probably benign 0.02
IGL02543:Olfr8 APN 10 78955939 missense probably damaging 1.00
IGL03323:Olfr8 APN 10 78955600 missense probably benign
PIT4466001:Olfr8 UTSW 10 78955842 missense probably benign 0.00
R1496:Olfr8 UTSW 10 78955848 missense probably benign 0.41
R1754:Olfr8 UTSW 10 78955697 missense probably damaging 0.99
R1878:Olfr8 UTSW 10 78955805 missense possibly damaging 0.62
R2760:Olfr8 UTSW 10 78956042 missense probably damaging 0.99
R4202:Olfr8 UTSW 10 78955295 missense probably benign
R4517:Olfr8 UTSW 10 78956043 nonsense probably null
R4613:Olfr8 UTSW 10 78956065 missense probably damaging 1.00
R4799:Olfr8 UTSW 10 78956097 missense probably null 0.92
R4979:Olfr8 UTSW 10 78955932 nonsense probably null
R5008:Olfr8 UTSW 10 78956071 missense probably damaging 1.00
R5700:Olfr8 UTSW 10 78955484 missense probably damaging 1.00
R5876:Olfr8 UTSW 10 78955357 missense probably benign 0.15
R6439:Olfr8 UTSW 10 78955984 missense probably damaging 1.00
R6930:Olfr8 UTSW 10 78955781 missense possibly damaging 0.84
R7110:Olfr8 UTSW 10 78955450 missense possibly damaging 0.83
R7405:Olfr8 UTSW 10 78955697 missense probably benign 0.14
R7524:Olfr8 UTSW 10 78955491 nonsense probably null
Z1176:Olfr8 UTSW 10 78955219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGAGTGAAAGGAATGTCTATC -3'
(R):5'- ATTTACCAGCATCTTTGGGACAGTG -3'

Sequencing Primer
(F):5'- AGAGACTCCATAAGAAGAACAATTTC -3'
(R):5'- TGGTGGAGGTGAAACAGATGTCC -3'
Posted On2015-06-10