Incidental Mutation 'R4206:Tex2'
ID318929
Institutional Source Beutler Lab
Gene Symbol Tex2
Ensembl Gene ENSMUSG00000040548
Gene Nametestis expressed gene 2
SynonymsDef-5, Taz4, 4930568E07Rik
MMRRC Submission 041035-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4206 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106502147-106613423 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 106567572 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000042780] [ENSMUST00000103070] [ENSMUST00000128933] [ENSMUST00000153870]
Predicted Effect unknown
Transcript: ENSMUST00000042780
AA Change: I344T
SMART Domains Protein: ENSMUSP00000041985
Gene: ENSMUSG00000040548
AA Change: I344T

DomainStartEndE-ValueType
low complexity region 119 186 N/A INTRINSIC
low complexity region 319 341 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
PH 543 712 5.05e-1 SMART
low complexity region 732 752 N/A INTRINSIC
low complexity region 811 823 N/A INTRINSIC
low complexity region 946 965 N/A INTRINSIC
low complexity region 1003 1016 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000103070
AA Change: I344T
SMART Domains Protein: ENSMUSP00000099359
Gene: ENSMUSG00000040548
AA Change: I344T

DomainStartEndE-ValueType
low complexity region 119 186 N/A INTRINSIC
low complexity region 319 341 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
PH 543 712 5.05e-1 SMART
low complexity region 732 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128933
SMART Domains Protein: ENSMUSP00000120781
Gene: ENSMUSG00000040548

DomainStartEndE-ValueType
low complexity region 119 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153870
Predicted Effect probably benign
Transcript: ENSMUST00000207249
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,473,515 K81R probably benign Het
Acacb T C 5: 114,213,651 F1150L probably benign Het
Acat3 A G 17: 12,927,386 Y237H possibly damaging Het
Arfgap3 T C 15: 83,322,668 T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cabin1 T C 10: 75,754,841 S23G possibly damaging Het
Clasp1 A G 1: 118,578,906 N949S probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dgka A T 10: 128,721,195 L637Q probably damaging Het
Dst G A 1: 34,212,247 R1801H probably damaging Het
Edil3 T C 13: 89,180,278 S284P probably damaging Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Ell2 A G 13: 75,761,948 D139G probably damaging Het
Fam187a A G 11: 102,886,212 R281G probably damaging Het
Gin1 A G 1: 97,792,420 D380G possibly damaging Het
Gpr149 T G 3: 62,604,503 D25A possibly damaging Het
Gyg A G 3: 20,152,737 S90P probably benign Het
Hpx C T 7: 105,595,147 M190I probably null Het
Irf2bpl C T 12: 86,883,036 V288I probably benign Het
Lyst A G 13: 13,635,989 H748R probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mpdz A T 4: 81,381,762 M333K probably benign Het
Muc5ac C T 7: 141,817,110 S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntsr1 A G 2: 180,500,752 D112G probably damaging Het
Olfr1410 A C 1: 92,608,595 T253P possibly damaging Het
Olfr657 T A 7: 104,636,149 N158K possibly damaging Het
Olfr8 T C 10: 78,955,283 F26S probably benign Het
Parg A G 14: 32,254,536 K178R probably benign Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pld1 G A 3: 28,120,783 V857I probably benign Het
Rad54l2 A C 9: 106,717,795 V321G probably damaging Het
Rcn2 A G 9: 56,045,207 Y112C possibly damaging Het
Rnf123 A T 9: 108,063,963 D639E probably benign Het
Rufy2 C T 10: 63,004,772 Q441* probably null Het
Scgb2b12 T C 7: 32,326,638 Y43C probably damaging Het
Scrn3 T A 2: 73,319,501 probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc22a8 T C 19: 8,608,233 S321P probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmem2 G T 19: 21,842,115 R1090L probably damaging Het
Trip13 A G 13: 73,932,890 I119T probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Ttn A G 2: 76,772,567 I16691T possibly damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 V142A probably damaging Het
Uggt2 C T 14: 119,049,262 D221N probably damaging Het
Wnt4 A G 4: 137,296,343 K207R possibly damaging Het
Zfp608 T C 18: 54,988,195 R107G probably damaging Het
Other mutations in Tex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tex2 APN 11 106568535 missense probably damaging 1.00
IGL01380:Tex2 APN 11 106544315 nonsense probably null
IGL02607:Tex2 APN 11 106546747 missense unknown
IGL02680:Tex2 APN 11 106568232 unclassified probably benign
IGL02699:Tex2 APN 11 106568433 missense possibly damaging 0.53
IGL03187:Tex2 APN 11 106568077 unclassified probably benign
IGL03398:Tex2 APN 11 106568272 missense probably damaging 1.00
R0242:Tex2 UTSW 11 106519955 nonsense probably null
R0242:Tex2 UTSW 11 106519955 nonsense probably null
R1085:Tex2 UTSW 11 106568487 missense probably damaging 0.98
R1491:Tex2 UTSW 11 106503640 missense possibly damaging 0.72
R1664:Tex2 UTSW 11 106567782 unclassified probably benign
R1794:Tex2 UTSW 11 106567902 unclassified probably benign
R1855:Tex2 UTSW 11 106546876 missense possibly damaging 0.87
R2077:Tex2 UTSW 11 106506864 splice site probably null
R2151:Tex2 UTSW 11 106567335 unclassified probably benign
R2175:Tex2 UTSW 11 106503687 missense unknown
R2984:Tex2 UTSW 11 106546663 critical splice donor site probably null
R3156:Tex2 UTSW 11 106533869 critical splice donor site probably null
R3722:Tex2 UTSW 11 106546740 nonsense probably null
R3724:Tex2 UTSW 11 106529330 missense unknown
R3770:Tex2 UTSW 11 106544252 missense unknown
R3771:Tex2 UTSW 11 106546894 missense unknown
R3813:Tex2 UTSW 11 106511944 missense unknown
R3947:Tex2 UTSW 11 106520003 missense unknown
R4342:Tex2 UTSW 11 106567006 unclassified probably benign
R4554:Tex2 UTSW 11 106544386 missense unknown
R4896:Tex2 UTSW 11 106568404 missense probably damaging 1.00
R5207:Tex2 UTSW 11 106546840 missense unknown
R5249:Tex2 UTSW 11 106546789 missense unknown
R5257:Tex2 UTSW 11 106567759 unclassified probably benign
R5258:Tex2 UTSW 11 106567759 unclassified probably benign
R5278:Tex2 UTSW 11 106567813 missense probably benign 0.34
R5702:Tex2 UTSW 11 106544395 missense possibly damaging 0.58
R5835:Tex2 UTSW 11 106519913 missense unknown
R6150:Tex2 UTSW 11 106567080 missense probably benign 0.34
R6785:Tex2 UTSW 11 106533950 missense probably damaging 1.00
R6879:Tex2 UTSW 11 106534010 missense unknown
R7038:Tex2 UTSW 11 106511900 critical splice donor site probably null
R7117:Tex2 UTSW 11 106544245 missense unknown
R7336:Tex2 UTSW 11 106548859 missense unknown
R7568:Tex2 UTSW 11 106548736 missense unknown
R7622:Tex2 UTSW 11 106546895 missense unknown
T0970:Tex2 UTSW 11 106546946 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCCGTGTACAGTTCACAGAAC -3'
(R):5'- ACTAAGCGACGCCTTTCTG -3'

Sequencing Primer
(F):5'- TGCTCACTAAAGCAGACAGAG -3'
(R):5'- GAAGTTATCTATGAGCCCTTCCAG -3'
Posted On2015-06-10