Incidental Mutation 'R4206:Ell2'
ID318934
Institutional Source Beutler Lab
Gene Symbol Ell2
Ensembl Gene ENSMUSG00000001542
Gene Nameelongation factor RNA polymerase II 2
Synonyms
MMRRC Submission 041035-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4206 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location75706757-75772364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75761948 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 139 (D139G)
Ref Sequence ENSEMBL: ENSMUSP00000152427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001583] [ENSMUST00000220572] [ENSMUST00000222194] [ENSMUST00000222853]
Predicted Effect probably damaging
Transcript: ENSMUST00000001583
AA Change: D271G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001583
Gene: ENSMUSG00000001542
AA Change: D271G

DomainStartEndE-ValueType
Pfam:ELL 11 291 2.4e-108 PFAM
low complexity region 362 401 N/A INTRINSIC
low complexity region 451 476 N/A INTRINSIC
Pfam:Occludin_ELL 531 632 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221979
Predicted Effect probably benign
Transcript: ENSMUST00000222194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222564
Predicted Effect probably damaging
Transcript: ENSMUST00000222853
AA Change: D139G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000222892
AA Change: D131G
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,473,515 K81R probably benign Het
Acacb T C 5: 114,213,651 F1150L probably benign Het
Acat3 A G 17: 12,927,386 Y237H possibly damaging Het
Arfgap3 T C 15: 83,322,668 T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cabin1 T C 10: 75,754,841 S23G possibly damaging Het
Clasp1 A G 1: 118,578,906 N949S probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dgka A T 10: 128,721,195 L637Q probably damaging Het
Dst G A 1: 34,212,247 R1801H probably damaging Het
Edil3 T C 13: 89,180,278 S284P probably damaging Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Fam187a A G 11: 102,886,212 R281G probably damaging Het
Gin1 A G 1: 97,792,420 D380G possibly damaging Het
Gpr149 T G 3: 62,604,503 D25A possibly damaging Het
Gyg A G 3: 20,152,737 S90P probably benign Het
Hpx C T 7: 105,595,147 M190I probably null Het
Irf2bpl C T 12: 86,883,036 V288I probably benign Het
Lyst A G 13: 13,635,989 H748R probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mpdz A T 4: 81,381,762 M333K probably benign Het
Muc5ac C T 7: 141,817,110 S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntsr1 A G 2: 180,500,752 D112G probably damaging Het
Olfr1410 A C 1: 92,608,595 T253P possibly damaging Het
Olfr657 T A 7: 104,636,149 N158K possibly damaging Het
Olfr8 T C 10: 78,955,283 F26S probably benign Het
Parg A G 14: 32,254,536 K178R probably benign Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pld1 G A 3: 28,120,783 V857I probably benign Het
Rad54l2 A C 9: 106,717,795 V321G probably damaging Het
Rcn2 A G 9: 56,045,207 Y112C possibly damaging Het
Rnf123 A T 9: 108,063,963 D639E probably benign Het
Rufy2 C T 10: 63,004,772 Q441* probably null Het
Scgb2b12 T C 7: 32,326,638 Y43C probably damaging Het
Scrn3 T A 2: 73,319,501 probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc22a8 T C 19: 8,608,233 S321P probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tex2 A G 11: 106,567,572 probably benign Het
Tmem2 G T 19: 21,842,115 R1090L probably damaging Het
Trip13 A G 13: 73,932,890 I119T probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Ttn A G 2: 76,772,567 I16691T possibly damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 V142A probably damaging Het
Uggt2 C T 14: 119,049,262 D221N probably damaging Het
Wnt4 A G 4: 137,296,343 K207R possibly damaging Het
Zfp608 T C 18: 54,988,195 R107G probably damaging Het
Other mutations in Ell2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ell2 APN 13 75756290 missense probably damaging 1.00
IGL01315:Ell2 APN 13 75762232 unclassified probably benign
IGL01446:Ell2 APN 13 75761991 missense probably benign 0.02
IGL02691:Ell2 APN 13 75756486 missense probably damaging 0.97
IGL02963:Ell2 APN 13 75769643 missense possibly damaging 0.48
IGL03035:Ell2 APN 13 75763648 nonsense probably null
enhancement UTSW 13 75770735 missense probably damaging 1.00
stilts UTSW 13 75763986 nonsense probably null
PIT4469001:Ell2 UTSW 13 75761892 missense probably damaging 0.99
R0123:Ell2 UTSW 13 75762140 splice site probably benign
R0321:Ell2 UTSW 13 75761888 missense probably damaging 1.00
R0594:Ell2 UTSW 13 75749993 missense probably damaging 1.00
R0892:Ell2 UTSW 13 75763639 missense probably damaging 0.97
R1078:Ell2 UTSW 13 75746419 splice site probably benign
R1696:Ell2 UTSW 13 75769558 missense probably damaging 1.00
R2325:Ell2 UTSW 13 75769626 missense probably damaging 1.00
R2886:Ell2 UTSW 13 75763785 missense probably damaging 1.00
R3760:Ell2 UTSW 13 75762162 missense probably benign 0.37
R4632:Ell2 UTSW 13 75769574 missense possibly damaging 0.84
R5068:Ell2 UTSW 13 75763618 missense probably benign 0.00
R6980:Ell2 UTSW 13 75756376 missense probably null
R6983:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R6984:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R6986:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7073:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7074:Ell2 UTSW 13 75761887 missense probably damaging 1.00
R7473:Ell2 UTSW 13 75750035 missense probably damaging 1.00
R7590:Ell2 UTSW 13 75770735 missense probably damaging 1.00
R7901:Ell2 UTSW 13 75763986 nonsense probably null
RF018:Ell2 UTSW 13 75763608 missense probably damaging 1.00
Z1088:Ell2 UTSW 13 75761873 critical splice acceptor site probably benign
Z1176:Ell2 UTSW 13 75756452 missense probably damaging 0.99
Z1176:Ell2 UTSW 13 75770689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTAAGGTAAACATATGAAGCAACC -3'
(R):5'- TTGTCTAAGTAATAAAGAGGACTCTGA -3'

Sequencing Primer
(F):5'- CTTTATGCACACATGTAGCAGAGG -3'
(R):5'- GAGGACTCTGAAATACACATAACAC -3'
Posted On2015-06-10