Mutagenetix > Incidental Mutation

Incidental Mutation 'R4206:Arfgap3'

318938

Institutional Source

Beutler Lab

Gene Symbol

Arfgap3

Ensembl Gene

ENSMUSG00000054277

Gene Name

ADP-ribosylation factor GTPase activating protein 3

Synonyms

1810004P07Rik, 0610009H19Rik, 1810035F16Rik, 9130416J18Rik

MMRRC Submission

041035-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.227) question?

Stock #

R4206 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83299739-83350247 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83322668 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 240 (T240A)

Ref Sequence

ENSEMBL: ENSMUSP00000154712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067215] [ENSMUST00000226124]

AlphaFold

Q9D8S3

Predicted Effect

probably benign
Transcript: ENSMUST00000067215
AA Change: T240A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000064893
Gene: ENSMUSG00000054277
AA Change: T240A

Domain	Start	End	E-Value	Type
ArfGap	10	126	7.18e-44	SMART
Blast:ArfGap	160	200	2e-6	BLAST
low complexity region	220	237	N/A	INTRINSIC
low complexity region	348	362	N/A	INTRINSIC
low complexity region	459	466	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226124
AA Change: T240A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,473,515	K81R	probably benign	Het
Acacb	T	C	5: 114,213,651	F1150L	probably benign	Het
Acat3	A	G	17: 12,927,386	Y237H	possibly damaging	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Cabin1	T	C	10: 75,754,841	S23G	possibly damaging	Het
Clasp1	A	G	1: 118,578,906	N949S	probably damaging	Het
Csrp1	T	G	1: 135,745,327	C61G	probably damaging	Het
Dgka	A	T	10: 128,721,195	L637Q	probably damaging	Het
Dst	G	A	1: 34,212,247	R1801H	probably damaging	Het
Edil3	T	C	13: 89,180,278	S284P	probably damaging	Het
Eif2d	A	G	1: 131,154,363	Y64C	probably damaging	Het
Ell2	A	G	13: 75,761,948	D139G	probably damaging	Het
Fam187a	A	G	11: 102,886,212	R281G	probably damaging	Het
Gin1	A	G	1: 97,792,420	D380G	possibly damaging	Het
Gpr149	T	G	3: 62,604,503	D25A	possibly damaging	Het
Gyg	A	G	3: 20,152,737	S90P	probably benign	Het
Hpx	C	T	7: 105,595,147	M190I	probably null	Het
Irf2bpl	C	T	12: 86,883,036	V288I	probably benign	Het
Lyst	A	G	13: 13,635,989	H748R	probably benign	Het
Mmrn1	G	A	6: 60,958,180	G220D	probably damaging	Het
Mpdz	A	T	4: 81,381,762	M333K	probably benign	Het
Muc5ac	C	T	7: 141,817,110	S2556F	possibly damaging	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Ntsr1	A	G	2: 180,500,752	D112G	probably damaging	Het
Olfr1410	A	C	1: 92,608,595	T253P	possibly damaging	Het
Olfr657	T	A	7: 104,636,149	N158K	possibly damaging	Het
Olfr8	T	C	10: 78,955,283	F26S	probably benign	Het
Parg	A	G	14: 32,254,536	K178R	probably benign	Het
Pde8b	C	A	13: 95,222,545	C90F	probably benign	Het
Pld1	G	A	3: 28,120,783	V857I	probably benign	Het
Rad54l2	A	C	9: 106,717,795	V321G	probably damaging	Het
Rcn2	A	G	9: 56,045,207	Y112C	possibly damaging	Het
Rnf123	A	T	9: 108,063,963	D639E	probably benign	Het
Rufy2	C	T	10: 63,004,772	Q441*	probably null	Het
Scgb2b12	T	C	7: 32,326,638	Y43C	probably damaging	Het
Scrn3	T	A	2: 73,319,501		probably null	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc22a8	T	C	19: 8,608,233	S321P	probably benign	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tex2	A	G	11: 106,567,572		probably benign	Het
Tmem2	G	T	19: 21,842,115	R1090L	probably damaging	Het
Trip13	A	G	13: 73,932,890	I119T	probably benign	Het
Tsku	C	T	7: 98,352,998	R42H	probably damaging	Het
Ttn	A	G	2: 76,772,567	I16691T	possibly damaging	Het
Tyr	A	G	7: 87,429,068	L528P	possibly damaging	Het
Ubxn2b	T	C	4: 6,204,565	V142A	probably damaging	Het
Uggt2	C	T	14: 119,049,262	D221N	probably damaging	Het
Wnt4	A	G	4: 137,296,343	K207R	possibly damaging	Het
Zfp608	T	C	18: 54,988,195	R107G	probably damaging	Het

Other mutations in Arfgap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00908:Arfgap3	APN	15	83322589	missense	probably benign	0.04
IGL01306:Arfgap3	APN	15	83313509	missense	possibly damaging	0.78
IGL01960:Arfgap3	APN	15	83313557	missense	probably benign	0.04
IGL03029:Arfgap3	APN	15	83322650	missense	probably damaging	1.00
IGL03036:Arfgap3	APN	15	83306926	missense	possibly damaging	0.91
IGL03328:Arfgap3	APN	15	83343081	missense	probably damaging	1.00
ANU23:Arfgap3	UTSW	15	83313509	missense	possibly damaging	0.78
R0103:Arfgap3	UTSW	15	83322721	splice site	probably benign
R0103:Arfgap3	UTSW	15	83322721	splice site	probably benign
R0125:Arfgap3	UTSW	15	83343139	missense	probably benign	0.01
R0243:Arfgap3	UTSW	15	83330513	splice site	probably benign
R0551:Arfgap3	UTSW	15	83343137	missense	probably damaging	1.00
R0557:Arfgap3	UTSW	15	83303185	missense	probably damaging	1.00
R0638:Arfgap3	UTSW	15	83308188	splice site	probably null
R1115:Arfgap3	UTSW	15	83330540	missense	probably benign	0.00
R1459:Arfgap3	UTSW	15	83306937	missense	probably benign	0.15
R1576:Arfgap3	UTSW	15	83313563	missense	possibly damaging	0.94
R1776:Arfgap3	UTSW	15	83343139	missense	probably benign	0.01
R1826:Arfgap3	UTSW	15	83303102	critical splice donor site	probably null
R2057:Arfgap3	UTSW	15	83310300	missense	probably benign
R2084:Arfgap3	UTSW	15	83334566	missense	probably damaging	0.96
R3407:Arfgap3	UTSW	15	83322607	missense	probably benign	0.00
R4072:Arfgap3	UTSW	15	83303129	missense	probably damaging	1.00
R4074:Arfgap3	UTSW	15	83303129	missense	probably damaging	1.00
R4449:Arfgap3	UTSW	15	83334558	missense	probably damaging	1.00
R5004:Arfgap3	UTSW	15	83310296	missense	possibly damaging	0.87
R5193:Arfgap3	UTSW	15	83332697	missense	probably benign	0.01
R5364:Arfgap3	UTSW	15	83314361	missense	probably damaging	1.00
R6142:Arfgap3	UTSW	15	83350127	missense	probably damaging	1.00
R6813:Arfgap3	UTSW	15	83330593	missense	probably benign	0.00
R7154:Arfgap3	UTSW	15	83336704	missense	probably damaging	1.00
R7422:Arfgap3	UTSW	15	83306949	missense	probably damaging	0.97
R7582:Arfgap3	UTSW	15	83303101	missense	possibly damaging	0.77
R7714:Arfgap3	UTSW	15	83308151	missense	probably benign	0.34
R8269:Arfgap3	UTSW	15	83310341	missense	probably benign	0.01
R9352:Arfgap3	UTSW	15	83306926	missense	possibly damaging	0.82
R9712:Arfgap3	UTSW	15	83313533	missense	probably benign	0.02
R9729:Arfgap3	UTSW	15	83308165	missense	probably damaging	1.00
Z1177:Arfgap3	UTSW	15	83332688	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCATGAAACTACACCCTGTATAGC -3'
(R):5'- ACTGTGCTAAGGACACTGCC -3'

Sequencing Primer
(F):5'- CTCACCAAAAATTCAAGGTATTTGG -3'
(R):5'- TAAGGACACTGCCAGCCTCG -3'

Posted On

2015-06-10