Incidental Mutation 'R4206:Arfgap3'
ID 318938
Institutional Source Beutler Lab
Gene Symbol Arfgap3
Ensembl Gene ENSMUSG00000054277
Gene Name ADP-ribosylation factor GTPase activating protein 3
Synonyms 1810035F16Rik, 1810004P07Rik, 9130416J18Rik, 0610009H19Rik
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.269) question?
Stock # R4206 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 83183940-83234448 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83206869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 240 (T240A)
Ref Sequence ENSEMBL: ENSMUSP00000154712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067215] [ENSMUST00000226124]
AlphaFold Q9D8S3
Predicted Effect probably benign
Transcript: ENSMUST00000067215
AA Change: T240A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064893
Gene: ENSMUSG00000054277
AA Change: T240A

DomainStartEndE-ValueType
ArfGap 10 126 7.18e-44 SMART
Blast:ArfGap 160 200 2e-6 BLAST
low complexity region 220 237 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
low complexity region 459 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226124
AA Change: T240A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,315,435 (GRCm39) K81R probably benign Het
Acacb T C 5: 114,351,712 (GRCm39) F1150L probably benign Het
Acat3 A G 17: 13,146,273 (GRCm39) Y237H possibly damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Cabin1 T C 10: 75,590,675 (GRCm39) S23G possibly damaging Het
Cemip2 G T 19: 21,819,479 (GRCm39) R1090L probably damaging Het
Clasp1 A G 1: 118,506,636 (GRCm39) N949S probably damaging Het
Csrp1 T G 1: 135,673,065 (GRCm39) C61G probably damaging Het
Dgka A T 10: 128,557,064 (GRCm39) L637Q probably damaging Het
Dst G A 1: 34,251,328 (GRCm39) R1801H probably damaging Het
Edil3 T C 13: 89,328,397 (GRCm39) S284P probably damaging Het
Eif2d A G 1: 131,082,100 (GRCm39) Y64C probably damaging Het
Ell2 A G 13: 75,910,067 (GRCm39) D139G probably damaging Het
Fam187a A G 11: 102,777,038 (GRCm39) R281G probably damaging Het
Gin1 A G 1: 97,720,145 (GRCm39) D380G possibly damaging Het
Gpr149 T G 3: 62,511,924 (GRCm39) D25A possibly damaging Het
Gyg1 A G 3: 20,206,901 (GRCm39) S90P probably benign Het
Hpx C T 7: 105,244,354 (GRCm39) M190I probably null Het
Irf2bpl C T 12: 86,929,810 (GRCm39) V288I probably benign Het
Lyst A G 13: 13,810,574 (GRCm39) H748R probably benign Het
Mmrn1 G A 6: 60,935,164 (GRCm39) G220D probably damaging Het
Mpdz A T 4: 81,299,999 (GRCm39) M333K probably benign Het
Muc5ac C T 7: 141,370,847 (GRCm39) S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Ntsr1 A G 2: 180,142,545 (GRCm39) D112G probably damaging Het
Or56b1 T A 7: 104,285,356 (GRCm39) N158K possibly damaging Het
Or7a42 T C 10: 78,791,117 (GRCm39) F26S probably benign Het
Or9s14 A C 1: 92,536,317 (GRCm39) T253P possibly damaging Het
Parg A G 14: 31,976,493 (GRCm39) K178R probably benign Het
Pde8b C A 13: 95,359,053 (GRCm39) C90F probably benign Het
Pld1 G A 3: 28,174,932 (GRCm39) V857I probably benign Het
Rad54l2 A C 9: 106,594,994 (GRCm39) V321G probably damaging Het
Rcn2 A G 9: 55,952,491 (GRCm39) Y112C possibly damaging Het
Rnf123 A T 9: 107,941,162 (GRCm39) D639E probably benign Het
Rufy2 C T 10: 62,840,551 (GRCm39) Q441* probably null Het
Scgb2b12 T C 7: 32,026,063 (GRCm39) Y43C probably damaging Het
Scrn3 T A 2: 73,149,845 (GRCm39) probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc22a8 T C 19: 8,585,597 (GRCm39) S321P probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tex2 A G 11: 106,458,398 (GRCm39) probably benign Het
Trip13 A G 13: 74,081,009 (GRCm39) I119T probably benign Het
Tsku C T 7: 98,002,205 (GRCm39) R42H probably damaging Het
Ttn A G 2: 76,602,911 (GRCm39) I16691T possibly damaging Het
Tyr A G 7: 87,078,276 (GRCm39) L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 (GRCm39) V142A probably damaging Het
Uggt2 C T 14: 119,286,674 (GRCm39) D221N probably damaging Het
Wnt4 A G 4: 137,023,654 (GRCm39) K207R possibly damaging Het
Zfp608 T C 18: 55,121,267 (GRCm39) R107G probably damaging Het
Other mutations in Arfgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Arfgap3 APN 15 83,206,790 (GRCm39) missense probably benign 0.04
IGL01306:Arfgap3 APN 15 83,197,710 (GRCm39) missense possibly damaging 0.78
IGL01960:Arfgap3 APN 15 83,197,758 (GRCm39) missense probably benign 0.04
IGL03029:Arfgap3 APN 15 83,206,851 (GRCm39) missense probably damaging 1.00
IGL03036:Arfgap3 APN 15 83,191,127 (GRCm39) missense possibly damaging 0.91
IGL03328:Arfgap3 APN 15 83,227,282 (GRCm39) missense probably damaging 1.00
ANU23:Arfgap3 UTSW 15 83,197,710 (GRCm39) missense possibly damaging 0.78
R0103:Arfgap3 UTSW 15 83,206,922 (GRCm39) splice site probably benign
R0103:Arfgap3 UTSW 15 83,206,922 (GRCm39) splice site probably benign
R0125:Arfgap3 UTSW 15 83,227,340 (GRCm39) missense probably benign 0.01
R0243:Arfgap3 UTSW 15 83,214,714 (GRCm39) splice site probably benign
R0551:Arfgap3 UTSW 15 83,227,338 (GRCm39) missense probably damaging 1.00
R0557:Arfgap3 UTSW 15 83,187,386 (GRCm39) missense probably damaging 1.00
R0638:Arfgap3 UTSW 15 83,192,389 (GRCm39) splice site probably null
R1115:Arfgap3 UTSW 15 83,214,741 (GRCm39) missense probably benign 0.00
R1459:Arfgap3 UTSW 15 83,191,138 (GRCm39) missense probably benign 0.15
R1576:Arfgap3 UTSW 15 83,197,764 (GRCm39) missense possibly damaging 0.94
R1776:Arfgap3 UTSW 15 83,227,340 (GRCm39) missense probably benign 0.01
R1826:Arfgap3 UTSW 15 83,187,303 (GRCm39) critical splice donor site probably null
R2057:Arfgap3 UTSW 15 83,194,501 (GRCm39) missense probably benign
R2084:Arfgap3 UTSW 15 83,218,767 (GRCm39) missense probably damaging 0.96
R3407:Arfgap3 UTSW 15 83,206,808 (GRCm39) missense probably benign 0.00
R4072:Arfgap3 UTSW 15 83,187,330 (GRCm39) missense probably damaging 1.00
R4074:Arfgap3 UTSW 15 83,187,330 (GRCm39) missense probably damaging 1.00
R4449:Arfgap3 UTSW 15 83,218,759 (GRCm39) missense probably damaging 1.00
R5004:Arfgap3 UTSW 15 83,194,497 (GRCm39) missense possibly damaging 0.87
R5193:Arfgap3 UTSW 15 83,216,898 (GRCm39) missense probably benign 0.01
R5364:Arfgap3 UTSW 15 83,198,562 (GRCm39) missense probably damaging 1.00
R6142:Arfgap3 UTSW 15 83,234,328 (GRCm39) missense probably damaging 1.00
R6813:Arfgap3 UTSW 15 83,214,794 (GRCm39) missense probably benign 0.00
R7154:Arfgap3 UTSW 15 83,220,905 (GRCm39) missense probably damaging 1.00
R7422:Arfgap3 UTSW 15 83,191,150 (GRCm39) missense probably damaging 0.97
R7582:Arfgap3 UTSW 15 83,187,302 (GRCm39) missense possibly damaging 0.77
R7714:Arfgap3 UTSW 15 83,192,352 (GRCm39) missense probably benign 0.34
R8269:Arfgap3 UTSW 15 83,194,542 (GRCm39) missense probably benign 0.01
R9352:Arfgap3 UTSW 15 83,191,127 (GRCm39) missense possibly damaging 0.82
R9712:Arfgap3 UTSW 15 83,197,734 (GRCm39) missense probably benign 0.02
R9729:Arfgap3 UTSW 15 83,192,366 (GRCm39) missense probably damaging 1.00
Z1177:Arfgap3 UTSW 15 83,216,889 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATGAAACTACACCCTGTATAGC -3'
(R):5'- ACTGTGCTAAGGACACTGCC -3'

Sequencing Primer
(F):5'- CTCACCAAAAATTCAAGGTATTTGG -3'
(R):5'- TAAGGACACTGCCAGCCTCG -3'
Posted On 2015-06-10