Incidental Mutation 'R4206:Slc22a8'
ID 318944
Institutional Source Beutler Lab
Gene Symbol Slc22a8
Ensembl Gene ENSMUSG00000063796
Gene Name solute carrier family 22 (organic anion transporter), member 8
Synonyms Roct, mOat3, OAT3
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4206 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 8591254-8611834 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8608233 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 321 (S321P)
Ref Sequence ENSEMBL: ENSMUSP00000131045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010251] [ENSMUST00000170817]
AlphaFold O88909
Predicted Effect probably benign
Transcript: ENSMUST00000010251
AA Change: S321P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000010251
Gene: ENSMUSG00000063796
AA Change: S321P

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Sugar_tr 73 506 6.8e-33 PFAM
Pfam:MFS_1 97 461 6.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170817
AA Change: S321P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131045
Gene: ENSMUSG00000063796
AA Change: S321P

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Sugar_tr 78 507 6.7e-34 PFAM
Pfam:MFS_1 97 461 6.8e-29 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased urinary urate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,473,515 K81R probably benign Het
Acacb T C 5: 114,213,651 F1150L probably benign Het
Acat3 A G 17: 12,927,386 Y237H possibly damaging Het
Arfgap3 T C 15: 83,322,668 T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cabin1 T C 10: 75,754,841 S23G possibly damaging Het
Clasp1 A G 1: 118,578,906 N949S probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dgka A T 10: 128,721,195 L637Q probably damaging Het
Dst G A 1: 34,212,247 R1801H probably damaging Het
Edil3 T C 13: 89,180,278 S284P probably damaging Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Ell2 A G 13: 75,761,948 D139G probably damaging Het
Fam187a A G 11: 102,886,212 R281G probably damaging Het
Gin1 A G 1: 97,792,420 D380G possibly damaging Het
Gpr149 T G 3: 62,604,503 D25A possibly damaging Het
Gyg A G 3: 20,152,737 S90P probably benign Het
Hpx C T 7: 105,595,147 M190I probably null Het
Irf2bpl C T 12: 86,883,036 V288I probably benign Het
Lyst A G 13: 13,635,989 H748R probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mpdz A T 4: 81,381,762 M333K probably benign Het
Muc5ac C T 7: 141,817,110 S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntsr1 A G 2: 180,500,752 D112G probably damaging Het
Olfr1410 A C 1: 92,608,595 T253P possibly damaging Het
Olfr657 T A 7: 104,636,149 N158K possibly damaging Het
Olfr8 T C 10: 78,955,283 F26S probably benign Het
Parg A G 14: 32,254,536 K178R probably benign Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pld1 G A 3: 28,120,783 V857I probably benign Het
Rad54l2 A C 9: 106,717,795 V321G probably damaging Het
Rcn2 A G 9: 56,045,207 Y112C possibly damaging Het
Rnf123 A T 9: 108,063,963 D639E probably benign Het
Rufy2 C T 10: 63,004,772 Q441* probably null Het
Scgb2b12 T C 7: 32,326,638 Y43C probably damaging Het
Scrn3 T A 2: 73,319,501 probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tex2 A G 11: 106,567,572 probably benign Het
Tmem2 G T 19: 21,842,115 R1090L probably damaging Het
Trip13 A G 13: 73,932,890 I119T probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Ttn A G 2: 76,772,567 I16691T possibly damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 V142A probably damaging Het
Uggt2 C T 14: 119,049,262 D221N probably damaging Het
Wnt4 A G 4: 137,296,343 K207R possibly damaging Het
Zfp608 T C 18: 54,988,195 R107G probably damaging Het
Other mutations in Slc22a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Slc22a8 APN 19 8594135 missense probably benign 0.37
IGL00679:Slc22a8 APN 19 8604855 missense possibly damaging 0.54
IGL00717:Slc22a8 APN 19 8609929 missense probably benign 0.02
IGL00974:Slc22a8 APN 19 8609926 missense probably damaging 1.00
IGL01104:Slc22a8 APN 19 8607965 missense possibly damaging 0.62
IGL01975:Slc22a8 APN 19 8605411 missense probably damaging 0.96
IGL02025:Slc22a8 APN 19 8594175 missense possibly damaging 0.65
IGL02353:Slc22a8 APN 19 8608255 missense possibly damaging 0.78
IGL02360:Slc22a8 APN 19 8608255 missense possibly damaging 0.78
IGL02535:Slc22a8 APN 19 8610203 missense probably benign
IGL02639:Slc22a8 APN 19 8593959 missense probably benign
IGL03167:Slc22a8 APN 19 8609958 missense probably damaging 1.00
IGL03368:Slc22a8 APN 19 8609119 splice site probably benign
R0333:Slc22a8 UTSW 19 8608150 splice site probably benign
R1290:Slc22a8 UTSW 19 8609911 missense probably damaging 1.00
R1773:Slc22a8 UTSW 19 8594229 missense probably damaging 1.00
R1861:Slc22a8 UTSW 19 8606139 missense probably damaging 1.00
R2516:Slc22a8 UTSW 19 8610195 missense probably benign
R2988:Slc22a8 UTSW 19 8610248 missense probably benign 0.00
R3914:Slc22a8 UTSW 19 8608186 missense probably damaging 1.00
R5092:Slc22a8 UTSW 19 8594164 missense probably damaging 1.00
R5463:Slc22a8 UTSW 19 8609274 missense probably benign 0.00
R5470:Slc22a8 UTSW 19 8607870 missense probably damaging 1.00
R6733:Slc22a8 UTSW 19 8609292 missense probably benign 0.01
R7009:Slc22a8 UTSW 19 8605417 missense probably benign 0.05
R7642:Slc22a8 UTSW 19 8610045 missense probably benign 0.00
R7684:Slc22a8 UTSW 19 8609930 missense probably benign 0.00
R7689:Slc22a8 UTSW 19 8607884 missense probably damaging 0.96
R7729:Slc22a8 UTSW 19 8593959 missense possibly damaging 0.95
R7879:Slc22a8 UTSW 19 8594022 missense probably benign 0.11
R8030:Slc22a8 UTSW 19 8610007 missense probably damaging 0.99
R8113:Slc22a8 UTSW 19 8605539 missense probably benign 0.00
R8280:Slc22a8 UTSW 19 8609263 nonsense probably null
R8492:Slc22a8 UTSW 19 8594231 missense probably damaging 1.00
R8509:Slc22a8 UTSW 19 8607975 critical splice donor site probably null
R8956:Slc22a8 UTSW 19 8609666 nonsense probably null
R9074:Slc22a8 UTSW 19 8609661 missense possibly damaging 0.60
R9158:Slc22a8 UTSW 19 8606063 missense probably damaging 1.00
R9349:Slc22a8 UTSW 19 8594105 missense probably benign 0.00
Z1176:Slc22a8 UTSW 19 8593922 missense probably benign 0.10
Z1177:Slc22a8 UTSW 19 8605423 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCCTGTTTCCTTGGCTTAGAGC -3'
(R):5'- TCAGCTGAATGTGGGGCTTC -3'

Sequencing Primer
(F):5'- GGCTTAGAGCTATATCCCATCTG -3'
(R):5'- TCTGGGATGGAAGCTGGCC -3'
Posted On 2015-06-10