Incidental Mutation 'R4206:Cemip2'
ID 318946
Institutional Source Beutler Lab
Gene Symbol Cemip2
Ensembl Gene ENSMUSG00000024754
Gene Name cell migration inducing hyaluronidase 2
Synonyms 3110012M15Rik, Tmem2
MMRRC Submission 041035-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.773) question?
Stock # R4206 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 21755706-21835724 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 21819479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1090 (R1090L)
Ref Sequence ENSEMBL: ENSMUSP00000093908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025663] [ENSMUST00000096194]
AlphaFold Q5FWI3
Predicted Effect probably damaging
Transcript: ENSMUST00000025663
AA Change: R1090L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025663
Gene: ENSMUSG00000024754
AA Change: R1090L

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Pfam:ILEI 265 360 2.1e-24 PFAM
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Pfam:ILEI 1243 1333 9e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096194
AA Change: R1090L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093908
Gene: ENSMUSG00000024754
AA Change: R1090L

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,315,435 (GRCm39) K81R probably benign Het
Acacb T C 5: 114,351,712 (GRCm39) F1150L probably benign Het
Acat3 A G 17: 13,146,273 (GRCm39) Y237H possibly damaging Het
Arfgap3 T C 15: 83,206,869 (GRCm39) T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 117,721,122 (GRCm39) probably benign Het
Cabin1 T C 10: 75,590,675 (GRCm39) S23G possibly damaging Het
Clasp1 A G 1: 118,506,636 (GRCm39) N949S probably damaging Het
Csrp1 T G 1: 135,673,065 (GRCm39) C61G probably damaging Het
Dgka A T 10: 128,557,064 (GRCm39) L637Q probably damaging Het
Dst G A 1: 34,251,328 (GRCm39) R1801H probably damaging Het
Edil3 T C 13: 89,328,397 (GRCm39) S284P probably damaging Het
Eif2d A G 1: 131,082,100 (GRCm39) Y64C probably damaging Het
Ell2 A G 13: 75,910,067 (GRCm39) D139G probably damaging Het
Fam187a A G 11: 102,777,038 (GRCm39) R281G probably damaging Het
Gin1 A G 1: 97,720,145 (GRCm39) D380G possibly damaging Het
Gpr149 T G 3: 62,511,924 (GRCm39) D25A possibly damaging Het
Gyg1 A G 3: 20,206,901 (GRCm39) S90P probably benign Het
Hpx C T 7: 105,244,354 (GRCm39) M190I probably null Het
Irf2bpl C T 12: 86,929,810 (GRCm39) V288I probably benign Het
Lyst A G 13: 13,810,574 (GRCm39) H748R probably benign Het
Mmrn1 G A 6: 60,935,164 (GRCm39) G220D probably damaging Het
Mpdz A T 4: 81,299,999 (GRCm39) M333K probably benign Het
Muc5ac C T 7: 141,370,847 (GRCm39) S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Ntsr1 A G 2: 180,142,545 (GRCm39) D112G probably damaging Het
Or56b1 T A 7: 104,285,356 (GRCm39) N158K possibly damaging Het
Or7a42 T C 10: 78,791,117 (GRCm39) F26S probably benign Het
Or9s14 A C 1: 92,536,317 (GRCm39) T253P possibly damaging Het
Parg A G 14: 31,976,493 (GRCm39) K178R probably benign Het
Pde8b C A 13: 95,359,053 (GRCm39) C90F probably benign Het
Pld1 G A 3: 28,174,932 (GRCm39) V857I probably benign Het
Rad54l2 A C 9: 106,594,994 (GRCm39) V321G probably damaging Het
Rcn2 A G 9: 55,952,491 (GRCm39) Y112C possibly damaging Het
Rnf123 A T 9: 107,941,162 (GRCm39) D639E probably benign Het
Rufy2 C T 10: 62,840,551 (GRCm39) Q441* probably null Het
Scgb2b12 T C 7: 32,026,063 (GRCm39) Y43C probably damaging Het
Scrn3 T A 2: 73,149,845 (GRCm39) probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc22a8 T C 19: 8,585,597 (GRCm39) S321P probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Tex2 A G 11: 106,458,398 (GRCm39) probably benign Het
Trip13 A G 13: 74,081,009 (GRCm39) I119T probably benign Het
Tsku C T 7: 98,002,205 (GRCm39) R42H probably damaging Het
Ttn A G 2: 76,602,911 (GRCm39) I16691T possibly damaging Het
Tyr A G 7: 87,078,276 (GRCm39) L528P possibly damaging Het
Ubxn2b T C 4: 6,204,565 (GRCm39) V142A probably damaging Het
Uggt2 C T 14: 119,286,674 (GRCm39) D221N probably damaging Het
Wnt4 A G 4: 137,023,654 (GRCm39) K207R possibly damaging Het
Zfp608 T C 18: 55,121,267 (GRCm39) R107G probably damaging Het
Other mutations in Cemip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Cemip2 APN 19 21,822,121 (GRCm39) missense possibly damaging 0.77
IGL01528:Cemip2 APN 19 21,812,909 (GRCm39) missense possibly damaging 0.95
IGL01642:Cemip2 APN 19 21,801,265 (GRCm39) missense probably damaging 1.00
IGL01693:Cemip2 APN 19 21,779,251 (GRCm39) missense probably benign 0.00
IGL02437:Cemip2 APN 19 21,789,342 (GRCm39) critical splice donor site probably null
IGL02869:Cemip2 APN 19 21,789,241 (GRCm39) missense probably damaging 0.99
IGL02880:Cemip2 APN 19 21,801,207 (GRCm39) missense possibly damaging 0.68
IGL02904:Cemip2 APN 19 21,801,207 (GRCm39) missense possibly damaging 0.68
IGL02941:Cemip2 APN 19 21,801,207 (GRCm39) missense possibly damaging 0.68
IGL02950:Cemip2 APN 19 21,819,564 (GRCm39) missense probably benign 0.07
IGL03066:Cemip2 APN 19 21,801,207 (GRCm39) missense possibly damaging 0.68
IGL03120:Cemip2 APN 19 21,801,207 (GRCm39) missense possibly damaging 0.68
R0005:Cemip2 UTSW 19 21,789,584 (GRCm39) missense probably damaging 0.98
R0496:Cemip2 UTSW 19 21,774,709 (GRCm39) missense possibly damaging 0.89
R0557:Cemip2 UTSW 19 21,789,267 (GRCm39) missense probably benign 0.05
R0620:Cemip2 UTSW 19 21,795,335 (GRCm39) missense probably benign
R1271:Cemip2 UTSW 19 21,801,268 (GRCm39) missense possibly damaging 0.92
R1435:Cemip2 UTSW 19 21,822,070 (GRCm39) missense probably benign
R1543:Cemip2 UTSW 19 21,789,937 (GRCm39) missense probably benign 0.03
R1558:Cemip2 UTSW 19 21,775,346 (GRCm39) nonsense probably null
R1658:Cemip2 UTSW 19 21,779,243 (GRCm39) missense probably damaging 1.00
R1744:Cemip2 UTSW 19 21,809,501 (GRCm39) nonsense probably null
R1859:Cemip2 UTSW 19 21,825,341 (GRCm39) missense possibly damaging 0.56
R1943:Cemip2 UTSW 19 21,825,404 (GRCm39) splice site probably null
R2001:Cemip2 UTSW 19 21,779,351 (GRCm39) missense probably benign 0.43
R2021:Cemip2 UTSW 19 21,822,114 (GRCm39) missense possibly damaging 0.91
R2177:Cemip2 UTSW 19 21,789,149 (GRCm39) missense possibly damaging 0.80
R2183:Cemip2 UTSW 19 21,801,157 (GRCm39) missense possibly damaging 0.81
R2921:Cemip2 UTSW 19 21,795,303 (GRCm39) missense possibly damaging 0.80
R2922:Cemip2 UTSW 19 21,795,303 (GRCm39) missense possibly damaging 0.80
R2923:Cemip2 UTSW 19 21,795,303 (GRCm39) missense possibly damaging 0.80
R3727:Cemip2 UTSW 19 21,822,075 (GRCm39) missense probably benign
R3730:Cemip2 UTSW 19 21,803,481 (GRCm39) missense probably damaging 0.97
R3790:Cemip2 UTSW 19 21,784,816 (GRCm39) missense probably damaging 1.00
R3831:Cemip2 UTSW 19 21,825,315 (GRCm39) missense probably damaging 0.97
R3858:Cemip2 UTSW 19 21,829,598 (GRCm39) missense probably benign 0.01
R3859:Cemip2 UTSW 19 21,829,598 (GRCm39) missense probably benign 0.01
R3899:Cemip2 UTSW 19 21,829,598 (GRCm39) missense probably benign 0.01
R4096:Cemip2 UTSW 19 21,770,016 (GRCm39) start codon destroyed probably null 0.99
R4480:Cemip2 UTSW 19 21,792,853 (GRCm39) missense probably benign 0.03
R4667:Cemip2 UTSW 19 21,822,145 (GRCm39) missense probably benign
R4667:Cemip2 UTSW 19 21,774,715 (GRCm39) missense probably benign 0.00
R4888:Cemip2 UTSW 19 21,833,528 (GRCm39) missense probably benign 0.00
R4914:Cemip2 UTSW 19 21,786,653 (GRCm39) missense probably benign 0.00
R5030:Cemip2 UTSW 19 21,819,469 (GRCm39) missense probably benign
R5329:Cemip2 UTSW 19 21,775,693 (GRCm39) missense probably benign 0.30
R5977:Cemip2 UTSW 19 21,803,447 (GRCm39) missense probably benign 0.01
R6013:Cemip2 UTSW 19 21,809,403 (GRCm39) missense possibly damaging 0.89
R6049:Cemip2 UTSW 19 21,803,490 (GRCm39) missense probably benign
R6199:Cemip2 UTSW 19 21,822,186 (GRCm39) missense probably benign 0.05
R6215:Cemip2 UTSW 19 21,789,751 (GRCm39) missense probably benign 0.02
R6273:Cemip2 UTSW 19 21,779,369 (GRCm39) missense probably damaging 1.00
R6429:Cemip2 UTSW 19 21,779,272 (GRCm39) missense probably benign 0.14
R6547:Cemip2 UTSW 19 21,822,195 (GRCm39) missense probably benign 0.01
R6630:Cemip2 UTSW 19 21,829,593 (GRCm39) missense probably damaging 0.99
R6870:Cemip2 UTSW 19 21,809,487 (GRCm39) missense possibly damaging 0.91
R7276:Cemip2 UTSW 19 21,812,824 (GRCm39) missense probably benign 0.14
R7336:Cemip2 UTSW 19 21,803,509 (GRCm39) nonsense probably null
R7363:Cemip2 UTSW 19 21,833,575 (GRCm39) missense probably benign
R7678:Cemip2 UTSW 19 21,775,480 (GRCm39) missense probably damaging 1.00
R7727:Cemip2 UTSW 19 21,807,321 (GRCm39) missense probably benign 0.00
R7820:Cemip2 UTSW 19 21,784,825 (GRCm39) missense probably damaging 0.98
R7837:Cemip2 UTSW 19 21,775,385 (GRCm39) missense probably benign 0.40
R7859:Cemip2 UTSW 19 21,809,539 (GRCm39) missense possibly damaging 0.95
R7954:Cemip2 UTSW 19 21,770,264 (GRCm39) missense probably damaging 1.00
R7964:Cemip2 UTSW 19 21,775,794 (GRCm39) critical splice donor site probably null
R8058:Cemip2 UTSW 19 21,829,695 (GRCm39) missense probably benign 0.12
R8251:Cemip2 UTSW 19 21,784,765 (GRCm39) missense possibly damaging 0.82
R8746:Cemip2 UTSW 19 21,803,465 (GRCm39) missense probably damaging 1.00
R8820:Cemip2 UTSW 19 21,784,818 (GRCm39) missense probably damaging 0.99
R8931:Cemip2 UTSW 19 21,770,323 (GRCm39) missense probably benign 0.01
R9022:Cemip2 UTSW 19 21,789,986 (GRCm39) critical splice donor site probably null
R9354:Cemip2 UTSW 19 21,779,389 (GRCm39) missense probably benign 0.00
R9480:Cemip2 UTSW 19 21,775,622 (GRCm39) missense possibly damaging 0.64
R9495:Cemip2 UTSW 19 21,779,249 (GRCm39) missense probably damaging 0.99
R9593:Cemip2 UTSW 19 21,803,453 (GRCm39) missense probably damaging 1.00
R9705:Cemip2 UTSW 19 21,784,788 (GRCm39) missense probably damaging 0.96
R9740:Cemip2 UTSW 19 21,822,105 (GRCm39) missense probably benign 0.00
Z1177:Cemip2 UTSW 19 21,833,093 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAAAGAAGTGTATTAGGCTCGGG -3'
(R):5'- TCAGCATCCCAGGGTTCTAAG -3'

Sequencing Primer
(F):5'- TGTATTAGGCTCGGGACTCAAAAG -3'
(R):5'- AGCATCCCAGGGTTCTAAGCTATG -3'
Posted On 2015-06-10