Incidental Mutation 'R4207:Fcgr3'
ID 318949
Institutional Source Beutler Lab
Gene Symbol Fcgr3
Ensembl Gene ENSMUSG00000059498
Gene Name Fc receptor, IgG, low affinity III
Synonyms FcgammaRIII, CD16, Fcg receptor III
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 170878743-170892504 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 170881644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 160 (K160N)
Ref Sequence ENSEMBL: ENSMUSP00000131836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164044] [ENSMUST00000164179] [ENSMUST00000169017]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000164044
AA Change: K161N

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131938
Gene: ENSMUSG00000059498
AA Change: K161N

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
IG 47 120 1.2e-1 SMART
IG 128 206 1.24e-8 SMART
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164179
SMART Domains Protein: ENSMUSP00000133039
Gene: ENSMUSG00000059498

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
PDB:3WJL|C 35 74 6e-11 PDB
SCOP:d1f2qa1 39 74 8e-7 SMART
Blast:IG 46 74 4e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168817
Predicted Effect probably benign
Transcript: ENSMUST00000169017
AA Change: K160N

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131836
Gene: ENSMUSG00000059498
AA Change: K160N

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
IG 46 119 1.2e-1 SMART
IG 127 205 1.24e-8 SMART
transmembrane domain 218 240 N/A INTRINSIC
Meta Mutation Damage Score 0.1650 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack IgG-mediated mast cell degranulation and have impaired IgG-dependent anaphylaxis and Arthus reactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Adgrg4 G A X: 55,964,109 (GRCm39) V1893I possibly damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Mthfsd A G 8: 121,832,365 (GRCm39) V133A probably damaging Het
Nav2 T A 7: 49,222,046 (GRCm39) probably null Het
Nav2 T A 7: 49,246,979 (GRCm39) I2168N probably damaging Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Pld5 T G 1: 175,821,441 (GRCm39) T242P probably damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rhag A T 17: 41,142,544 (GRCm39) I250F probably damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Scaf4 C T 16: 90,057,103 (GRCm39) V83I unknown Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r85 A C 10: 130,254,574 (GRCm39) C703W probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Zfp81 C T 17: 33,553,890 (GRCm39) C308Y probably damaging Het
Other mutations in Fcgr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Fcgr3 APN 1 170,886,849 (GRCm39) missense probably damaging 1.00
PIT4696001:Fcgr3 UTSW 1 170,885,319 (GRCm39) missense probably damaging 1.00
R1722:Fcgr3 UTSW 1 170,881,688 (GRCm39) missense possibly damaging 0.89
R3734:Fcgr3 UTSW 1 170,885,443 (GRCm39) missense probably benign 0.04
R5885:Fcgr3 UTSW 1 170,885,280 (GRCm39) missense probably damaging 1.00
R7237:Fcgr3 UTSW 1 170,886,870 (GRCm39) missense probably damaging 1.00
R7429:Fcgr3 UTSW 1 170,885,442 (GRCm39) missense probably benign
R7514:Fcgr3 UTSW 1 170,886,912 (GRCm39) missense probably benign 0.01
R7692:Fcgr3 UTSW 1 170,881,661 (GRCm39) missense probably damaging 1.00
R9496:Fcgr3 UTSW 1 170,879,386 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGACACCAGACAGAATGTTTTG -3'
(R):5'- GAGAGATAGCTACAGCACTTGG -3'

Sequencing Primer
(F):5'- GGTGCTGTGTACTTCCTA -3'
(R):5'- AGCTACAGCACTTGGGTATC -3'
Posted On 2015-06-10