Incidental Mutation 'R4207:Pld5'
ID 318951
Institutional Source Beutler Lab
Gene Symbol Pld5
Ensembl Gene ENSMUSG00000055214
Gene Name phospholipase D family member 5
Synonyms B230365F16Rik
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 175789872-176102878 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 175821441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 242 (T242P)
Ref Sequence ENSEMBL: ENSMUSP00000106797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000111167] [ENSMUST00000125404]
AlphaFold Q3UNN8
Predicted Effect probably damaging
Transcript: ENSMUST00000065967
AA Change: T304P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214
AA Change: T304P

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111167
AA Change: T242P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106797
Gene: ENSMUSG00000055214
AA Change: T242P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PLDc 153 180 3.62e-3 SMART
PLDc 372 398 6.11e0 SMART
low complexity region 449 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125404
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144340
Meta Mutation Damage Score 0.3003 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Adgrg4 G A X: 55,964,109 (GRCm39) V1893I possibly damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Fcgr3 T A 1: 170,881,644 (GRCm39) K160N probably benign Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Mthfsd A G 8: 121,832,365 (GRCm39) V133A probably damaging Het
Nav2 T A 7: 49,246,979 (GRCm39) I2168N probably damaging Het
Nav2 T A 7: 49,222,046 (GRCm39) probably null Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rhag A T 17: 41,142,544 (GRCm39) I250F probably damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Scaf4 C T 16: 90,057,103 (GRCm39) V83I unknown Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r85 A C 10: 130,254,574 (GRCm39) C703W probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Zfp81 C T 17: 33,553,890 (GRCm39) C308Y probably damaging Het
Other mutations in Pld5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pld5 APN 1 175,967,585 (GRCm39) missense probably damaging 1.00
IGL00949:Pld5 APN 1 175,803,039 (GRCm39) missense probably damaging 1.00
IGL01067:Pld5 APN 1 176,102,445 (GRCm39) utr 5 prime probably benign
IGL02174:Pld5 APN 1 176,102,310 (GRCm39) missense possibly damaging 0.86
IGL02380:Pld5 APN 1 175,967,610 (GRCm39) missense probably damaging 0.97
IGL02879:Pld5 APN 1 175,798,157 (GRCm39) missense probably damaging 1.00
R0087:Pld5 UTSW 1 175,812,025 (GRCm39) missense probably damaging 0.98
R0135:Pld5 UTSW 1 175,798,155 (GRCm39) missense probably damaging 1.00
R0144:Pld5 UTSW 1 175,798,107 (GRCm39) missense probably benign 0.00
R0362:Pld5 UTSW 1 175,803,146 (GRCm39) nonsense probably null
R0453:Pld5 UTSW 1 175,917,522 (GRCm39) missense possibly damaging 0.75
R0454:Pld5 UTSW 1 176,102,295 (GRCm39) missense probably benign 0.00
R0722:Pld5 UTSW 1 175,803,081 (GRCm39) missense probably benign 0.34
R0751:Pld5 UTSW 1 175,872,462 (GRCm39) missense probably damaging 0.98
R0785:Pld5 UTSW 1 175,803,018 (GRCm39) splice site probably benign
R1184:Pld5 UTSW 1 175,872,462 (GRCm39) missense probably damaging 0.98
R1501:Pld5 UTSW 1 175,803,087 (GRCm39) missense probably benign 0.36
R1644:Pld5 UTSW 1 175,803,192 (GRCm39) missense possibly damaging 0.86
R2012:Pld5 UTSW 1 175,791,579 (GRCm39) missense probably benign 0.27
R2426:Pld5 UTSW 1 175,791,542 (GRCm39) missense probably benign
R3508:Pld5 UTSW 1 175,821,603 (GRCm39) missense probably damaging 1.00
R3917:Pld5 UTSW 1 175,791,504 (GRCm39) missense probably benign 0.00
R4373:Pld5 UTSW 1 175,967,583 (GRCm39) missense probably damaging 1.00
R4828:Pld5 UTSW 1 176,102,433 (GRCm39) missense probably benign 0.06
R4831:Pld5 UTSW 1 176,102,450 (GRCm39) utr 5 prime probably benign
R5861:Pld5 UTSW 1 175,917,571 (GRCm39) missense probably damaging 1.00
R6182:Pld5 UTSW 1 175,872,420 (GRCm39) missense probably benign 0.35
R6191:Pld5 UTSW 1 175,798,100 (GRCm39) missense probably benign 0.04
R6246:Pld5 UTSW 1 175,791,475 (GRCm39) nonsense probably null
R6737:Pld5 UTSW 1 175,917,588 (GRCm39) missense probably damaging 1.00
R7082:Pld5 UTSW 1 175,917,442 (GRCm39) missense probably benign 0.21
R7164:Pld5 UTSW 1 176,041,187 (GRCm39) start codon destroyed probably null 0.00
R7237:Pld5 UTSW 1 176,102,301 (GRCm39) missense possibly damaging 0.79
R7635:Pld5 UTSW 1 175,821,416 (GRCm39) critical splice donor site probably null
R7805:Pld5 UTSW 1 175,872,480 (GRCm39) missense probably damaging 1.00
R7967:Pld5 UTSW 1 176,102,264 (GRCm39) missense probably benign 0.03
R8038:Pld5 UTSW 1 175,872,463 (GRCm39) missense probably benign 0.19
R8995:Pld5 UTSW 1 175,791,580 (GRCm39) missense probably benign 0.01
R9033:Pld5 UTSW 1 175,967,585 (GRCm39) missense probably damaging 0.99
R9067:Pld5 UTSW 1 175,917,474 (GRCm39) missense probably benign 0.00
R9156:Pld5 UTSW 1 175,902,003 (GRCm39) missense probably benign 0.05
R9156:Pld5 UTSW 1 175,803,104 (GRCm39) missense possibly damaging 0.73
R9712:Pld5 UTSW 1 175,791,572 (GRCm39) missense probably benign 0.01
X0004:Pld5 UTSW 1 176,089,088 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGATTTTGTGCCACCGGAAG -3'
(R):5'- TGAAAGAACTCGGTGTCATCTTCTAC -3'

Sequencing Primer
(F):5'- CCAGTCAACATTCCATGATGGGG -3'
(R):5'- TACAACTGCAGCTGCCTG -3'
Posted On 2015-06-10