Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Zfp292'

318955

Institutional Source

Beutler Lab

Gene Symbol

Zfp292

Ensembl Gene

ENSMUSG00000039967

Gene Name

zinc finger protein 292

Synonyms

Zn-16, 5730450D02Rik, Zfp15, Zn-15, Zfp-15, 9430062L07Rik, Krox-10

MMRRC Submission

041036-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.744) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34803113-34882960 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34806079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 2322 (I2322V)

Ref Sequence

ENSEMBL: ENSMUSP00000095766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]

AlphaFold

Q9Z2U2

Predicted Effect

probably benign
Transcript: ENSMUST00000047950
AA Change: I2327V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: I2327V

Domain	Start	End	E-Value	Type
low complexity region	19	39	N/A	INTRINSIC
low complexity region	101	120	N/A	INTRINSIC
low complexity region	512	523	N/A	INTRINSIC
ZnF_C2H2	540	561	5.12e1	SMART
ZnF_C2H2	567	589	4.72e-2	SMART
low complexity region	649	664	N/A	INTRINSIC
ZnF_C2H2	681	705	3.52e-1	SMART
ZnF_C2H2	722	744	1.53e-1	SMART
ZnF_C2H2	750	774	1.62e0	SMART
ZnF_C2H2	779	803	1.08e1	SMART
ZnF_C2H2	807	831	1.95e-3	SMART
low complexity region	1062	1078	N/A	INTRINSIC
ZnF_C2H2	1085	1110	7.67e-2	SMART
ZnF_C2H2	1361	1381	1.93e2	SMART
low complexity region	1606	1618	N/A	INTRINSIC
ZnF_C2H2	1879	1904	4.4e-2	SMART
ZnF_C2H2	1924	1949	5.42e-2	SMART
low complexity region	2004	2014	N/A	INTRINSIC
low complexity region	2024	2037	N/A	INTRINSIC
coiled coil region	2050	2072	N/A	INTRINSIC
ZnF_C2H2	2091	2116	4.45e0	SMART
low complexity region	2121	2143	N/A	INTRINSIC
ZnF_C2H2	2149	2174	1.64e-1	SMART
ZnF_C2H2	2193	2218	3.24e0	SMART
ZnF_C2H2	2233	2258	1.18e-2	SMART
low complexity region	2301	2314	N/A	INTRINSIC
ZnF_C2H2	2362	2386	2.86e-1	SMART
low complexity region	2589	2605	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098163
AA Change: I2322V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: I2322V

Domain	Start	End	E-Value	Type
low complexity region	19	39	N/A	INTRINSIC
low complexity region	101	120	N/A	INTRINSIC
low complexity region	507	518	N/A	INTRINSIC
ZnF_C2H2	535	556	5.12e1	SMART
ZnF_C2H2	562	584	4.72e-2	SMART
low complexity region	644	659	N/A	INTRINSIC
ZnF_C2H2	676	700	3.52e-1	SMART
ZnF_C2H2	717	739	1.53e-1	SMART
ZnF_C2H2	745	769	1.62e0	SMART
ZnF_C2H2	774	798	1.08e1	SMART
ZnF_C2H2	802	826	1.95e-3	SMART
low complexity region	1057	1073	N/A	INTRINSIC
ZnF_C2H2	1080	1105	7.67e-2	SMART
ZnF_C2H2	1356	1376	1.93e2	SMART
low complexity region	1601	1613	N/A	INTRINSIC
ZnF_C2H2	1874	1899	4.4e-2	SMART
ZnF_C2H2	1919	1944	5.42e-2	SMART
low complexity region	1999	2009	N/A	INTRINSIC
low complexity region	2019	2032	N/A	INTRINSIC
coiled coil region	2045	2067	N/A	INTRINSIC
ZnF_C2H2	2086	2111	4.45e0	SMART
low complexity region	2116	2138	N/A	INTRINSIC
ZnF_C2H2	2144	2169	1.64e-1	SMART
ZnF_C2H2	2188	2213	3.24e0	SMART
ZnF_C2H2	2228	2253	1.18e-2	SMART
low complexity region	2296	2309	N/A	INTRINSIC
ZnF_C2H2	2357	2381	2.86e-1	SMART
low complexity region	2584	2600	N/A	INTRINSIC

Meta Mutation Damage Score

0.0725

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Ap1b1	A	G	11: 5,031,637	D515G	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Cand1	T	C	10: 119,211,845	D580G	probably damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ctnnd2	G	T	15: 30,972,827	V1033F	probably damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nav2	T	A	7: 49,572,298		probably null	Het
Nav2	T	A	7: 49,597,231	I2168N	probably damaging	Het
Nlrp10	T	A	7: 108,924,341	D644V	possibly damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Slc5a8	G	T	10: 88,911,413	L409F	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp644	T	C	5: 106,618,276	E93G	probably damaging	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Zfp292

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Zfp292	APN	4	34808683	missense	probably benign	0.15
IGL00502:Zfp292	APN	4	34809775	missense	possibly damaging	0.63
IGL00539:Zfp292	APN	4	34808790	missense	probably damaging	0.98
IGL00676:Zfp292	APN	4	34807827	missense	probably damaging	0.99
IGL01068:Zfp292	APN	4	34806763	missense	probably damaging	1.00
IGL01311:Zfp292	APN	4	34807961	missense	probably benign	0.01
IGL01639:Zfp292	APN	4	34809048	missense	probably benign	0.04
IGL01688:Zfp292	APN	4	34807855	missense	possibly damaging	0.93
IGL02345:Zfp292	APN	4	34809244	missense	possibly damaging	0.94
IGL02444:Zfp292	APN	4	34808810	missense	possibly damaging	0.87
IGL02548:Zfp292	APN	4	34805416	missense	probably damaging	1.00
IGL02551:Zfp292	APN	4	34806462	missense	possibly damaging	0.93
IGL02702:Zfp292	APN	4	34809415	missense	probably benign	0.14
IGL02715:Zfp292	APN	4	34819542	missense	probably damaging	1.00
IGL03273:Zfp292	APN	4	34806163	missense	probably benign	0.00
F5770:Zfp292	UTSW	4	34806783	missense	possibly damaging	0.85
PIT4362001:Zfp292	UTSW	4	34807524	missense	probably benign	0.00
R0153:Zfp292	UTSW	4	34811185	missense	probably benign	0.26
R0184:Zfp292	UTSW	4	34819563	missense	probably damaging	1.00
R0295:Zfp292	UTSW	4	34806281	missense	probably damaging	1.00
R0367:Zfp292	UTSW	4	34808227	missense	probably benign	0.25
R0433:Zfp292	UTSW	4	34839959	missense	probably damaging	0.99
R0481:Zfp292	UTSW	4	34810059	missense	probably benign	0.28
R0555:Zfp292	UTSW	4	34807194	missense	probably damaging	1.00
R0597:Zfp292	UTSW	4	34807399	missense	probably benign	0.02
R0748:Zfp292	UTSW	4	34816424	splice site	probably benign
R0782:Zfp292	UTSW	4	34839382	missense	possibly damaging	0.94
R0834:Zfp292	UTSW	4	34809114	missense	probably benign	0.00
R0879:Zfp292	UTSW	4	34811218	missense	probably benign	0.00
R1083:Zfp292	UTSW	4	34807569	missense	probably damaging	0.98
R1343:Zfp292	UTSW	4	34805238	missense	probably damaging	0.98
R1498:Zfp292	UTSW	4	34805397	missense	possibly damaging	0.88
R1714:Zfp292	UTSW	4	34808935	missense	probably damaging	1.00
R1724:Zfp292	UTSW	4	34811237	missense	probably damaging	1.00
R1755:Zfp292	UTSW	4	34811043	missense	probably benign	0.02
R1837:Zfp292	UTSW	4	34810264	missense	probably damaging	0.98
R1914:Zfp292	UTSW	4	34805100	missense	possibly damaging	0.92
R1915:Zfp292	UTSW	4	34805100	missense	possibly damaging	0.92
R1936:Zfp292	UTSW	4	34807452	missense	probably benign	0.22
R2107:Zfp292	UTSW	4	34808593	missense	possibly damaging	0.86
R2108:Zfp292	UTSW	4	34808593	missense	possibly damaging	0.86
R2136:Zfp292	UTSW	4	34810266	missense	probably benign	0.13
R2182:Zfp292	UTSW	4	34807417	missense	probably damaging	1.00
R2186:Zfp292	UTSW	4	34807962	missense	probably benign	0.07
R2306:Zfp292	UTSW	4	34809468	missense	probably damaging	0.96
R2350:Zfp292	UTSW	4	34811281	missense	probably damaging	1.00
R2382:Zfp292	UTSW	4	34806426	missense	possibly damaging	0.91
R2872:Zfp292	UTSW	4	34808595	missense	probably damaging	1.00
R2872:Zfp292	UTSW	4	34808595	missense	probably damaging	1.00
R3018:Zfp292	UTSW	4	34808814	missense	probably damaging	0.99
R3812:Zfp292	UTSW	4	34810326	missense	probably damaging	0.98
R4006:Zfp292	UTSW	4	34807744	missense	probably benign	0.00
R4006:Zfp292	UTSW	4	34809611	missense	possibly damaging	0.62
R4060:Zfp292	UTSW	4	34810863	missense	probably damaging	1.00
R4062:Zfp292	UTSW	4	34810863	missense	probably damaging	1.00
R4063:Zfp292	UTSW	4	34810863	missense	probably damaging	1.00
R4064:Zfp292	UTSW	4	34810863	missense	probably damaging	1.00
R4641:Zfp292	UTSW	4	34807828	missense	probably damaging	0.99
R4684:Zfp292	UTSW	4	34807078	missense	probably benign	0.00
R4718:Zfp292	UTSW	4	34819521	missense	possibly damaging	0.92
R4865:Zfp292	UTSW	4	34819563	missense	probably damaging	1.00
R4870:Zfp292	UTSW	4	34808917	missense	probably damaging	1.00
R5097:Zfp292	UTSW	4	34839878	missense	possibly damaging	0.89
R5233:Zfp292	UTSW	4	34809755	missense	probably damaging	1.00
R5246:Zfp292	UTSW	4	34805842	missense	possibly damaging	0.76
R5369:Zfp292	UTSW	4	34807491	missense	possibly damaging	0.89
R5527:Zfp292	UTSW	4	34806261	missense	probably damaging	1.00
R5621:Zfp292	UTSW	4	34811703	missense	probably damaging	0.98
R5770:Zfp292	UTSW	4	34806747	missense	probably damaging	1.00
R5900:Zfp292	UTSW	4	34805125	missense	probably damaging	1.00
R5905:Zfp292	UTSW	4	34819549	missense	probably damaging	1.00
R5994:Zfp292	UTSW	4	34805464	missense	possibly damaging	0.87
R6028:Zfp292	UTSW	4	34819549	missense	probably damaging	1.00
R6056:Zfp292	UTSW	4	34809784	missense	probably damaging	1.00
R6093:Zfp292	UTSW	4	34811902	missense	probably damaging	1.00
R6126:Zfp292	UTSW	4	34808497	missense	probably benign	0.13
R6209:Zfp292	UTSW	4	34809442	missense	probably benign	0.14
R6275:Zfp292	UTSW	4	34808883	missense	possibly damaging	0.93
R6523:Zfp292	UTSW	4	34816301	missense	probably benign	0.21
R6747:Zfp292	UTSW	4	34806894	missense	probably damaging	0.97
R6752:Zfp292	UTSW	4	34808593	missense	possibly damaging	0.86
R6967:Zfp292	UTSW	4	34807812	missense	probably damaging	1.00
R7038:Zfp292	UTSW	4	34816357	missense	probably damaging	1.00
R7056:Zfp292	UTSW	4	34809784	missense	probably damaging	1.00
R7088:Zfp292	UTSW	4	34806796	missense	probably damaging	1.00
R7158:Zfp292	UTSW	4	34808679	missense	probably benign
R7254:Zfp292	UTSW	4	34819476	missense	probably damaging	0.98
R7350:Zfp292	UTSW	4	34806839	missense	probably benign
R7378:Zfp292	UTSW	4	34808384	missense	probably benign	0.26
R7535:Zfp292	UTSW	4	34811487	missense	probably benign	0.28
R7589:Zfp292	UTSW	4	34806777	missense	probably damaging	1.00
R7816:Zfp292	UTSW	4	34809865	missense	probably benign	0.02
R7979:Zfp292	UTSW	4	34809198	missense	probably benign	0.02
R7997:Zfp292	UTSW	4	34808688	missense	probably damaging	0.96
R8129:Zfp292	UTSW	4	34807386	missense	probably damaging	1.00
R8211:Zfp292	UTSW	4	34806163	missense	probably benign	0.00
R8302:Zfp292	UTSW	4	34810893	missense	possibly damaging	0.64
R8500:Zfp292	UTSW	4	34826691	critical splice donor site	probably null
R8709:Zfp292	UTSW	4	34805982	missense	probably damaging	1.00
R8947:Zfp292	UTSW	4	34811835	missense	probably damaging	1.00
R9099:Zfp292	UTSW	4	34809228	missense	possibly damaging	0.53
R9190:Zfp292	UTSW	4	34819563	missense	probably damaging	1.00
R9256:Zfp292	UTSW	4	34839899	missense	probably benign	0.02
R9371:Zfp292	UTSW	4	34810800	missense	probably damaging	1.00
R9492:Zfp292	UTSW	4	34810794	missense	probably benign	0.12
R9574:Zfp292	UTSW	4	34839460	missense	probably damaging	1.00
V7580:Zfp292	UTSW	4	34806783	missense	possibly damaging	0.85
V7581:Zfp292	UTSW	4	34806783	missense	possibly damaging	0.85
V7582:Zfp292	UTSW	4	34806783	missense	possibly damaging	0.85
V7583:Zfp292	UTSW	4	34806783	missense	possibly damaging	0.85
Z1177:Zfp292	UTSW	4	34811058	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTGATGTAAATGCCCTGGAC -3'
(R):5'- TAAAGCCCATCTGATTCGGC -3'

Sequencing Primer
(F):5'- TGCCCTGGACAACTTATGAC -3'
(R):5'- TTCGGCCAAGAAAATTAACTGGC -3'

Posted On

2015-06-10