Incidental Mutation 'R4207:Lingo2'
ID 318956
Institutional Source Beutler Lab
Gene Symbol Lingo2
Ensembl Gene ENSMUSG00000045083
Gene Name leucine rich repeat and Ig domain containing 2
Synonyms Lrrn6c, LERN3, B230217C06Rik
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 35706647-36951747 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35709810 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 57 (I57V)
Ref Sequence ENSEMBL: ENSMUSP00000130423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065173] [ENSMUST00000098151] [ENSMUST00000108122] [ENSMUST00000108124] [ENSMUST00000164772]
AlphaFold Q3URE9
Predicted Effect probably benign
Transcript: ENSMUST00000065173
AA Change: I57V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000069772
Gene: ENSMUSG00000045083
AA Change: I57V

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098151
AA Change: I57V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095754
Gene: ENSMUSG00000045083
AA Change: I57V

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108122
AA Change: I57V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103757
Gene: ENSMUSG00000045083
AA Change: I57V

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108124
AA Change: I57V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103759
Gene: ENSMUSG00000045083
AA Change: I57V

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164772
AA Change: I57V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130423
Gene: ENSMUSG00000045083
AA Change: I57V

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Meta Mutation Damage Score 0.0700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Adgrg4 G A X: 55,964,109 (GRCm39) V1893I possibly damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Fcgr3 T A 1: 170,881,644 (GRCm39) K160N probably benign Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Mthfsd A G 8: 121,832,365 (GRCm39) V133A probably damaging Het
Nav2 T A 7: 49,222,046 (GRCm39) probably null Het
Nav2 T A 7: 49,246,979 (GRCm39) I2168N probably damaging Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Pld5 T G 1: 175,821,441 (GRCm39) T242P probably damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rhag A T 17: 41,142,544 (GRCm39) I250F probably damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Scaf4 C T 16: 90,057,103 (GRCm39) V83I unknown Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r85 A C 10: 130,254,574 (GRCm39) C703W probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Zfp81 C T 17: 33,553,890 (GRCm39) C308Y probably damaging Het
Other mutations in Lingo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Lingo2 APN 4 35,709,526 (GRCm39) missense probably benign 0.31
IGL02532:Lingo2 APN 4 35,709,171 (GRCm39) missense possibly damaging 0.69
IGL02999:Lingo2 APN 4 35,708,744 (GRCm39) missense probably damaging 1.00
R0077:Lingo2 UTSW 4 35,708,375 (GRCm39) missense possibly damaging 0.51
R0669:Lingo2 UTSW 4 35,709,120 (GRCm39) missense probably benign 0.00
R1195:Lingo2 UTSW 4 35,708,538 (GRCm39) missense probably damaging 1.00
R1195:Lingo2 UTSW 4 35,708,538 (GRCm39) missense probably damaging 1.00
R1195:Lingo2 UTSW 4 35,708,538 (GRCm39) missense probably damaging 1.00
R1403:Lingo2 UTSW 4 35,709,420 (GRCm39) missense possibly damaging 0.83
R1403:Lingo2 UTSW 4 35,709,420 (GRCm39) missense possibly damaging 0.83
R1552:Lingo2 UTSW 4 35,708,315 (GRCm39) missense probably damaging 0.99
R2066:Lingo2 UTSW 4 35,709,179 (GRCm39) missense probably benign
R4208:Lingo2 UTSW 4 35,709,810 (GRCm39) missense probably benign 0.01
R4326:Lingo2 UTSW 4 35,708,462 (GRCm39) missense probably damaging 1.00
R4327:Lingo2 UTSW 4 35,708,462 (GRCm39) missense probably damaging 1.00
R4328:Lingo2 UTSW 4 35,708,462 (GRCm39) missense probably damaging 1.00
R4474:Lingo2 UTSW 4 35,708,810 (GRCm39) missense probably benign
R6801:Lingo2 UTSW 4 35,709,566 (GRCm39) missense probably damaging 0.97
R7343:Lingo2 UTSW 4 35,709,450 (GRCm39) missense possibly damaging 0.88
R7629:Lingo2 UTSW 4 35,708,675 (GRCm39) missense possibly damaging 0.88
R7740:Lingo2 UTSW 4 35,709,248 (GRCm39) missense probably damaging 0.98
R7867:Lingo2 UTSW 4 35,709,302 (GRCm39) missense probably benign
R7995:Lingo2 UTSW 4 35,709,425 (GRCm39) missense probably damaging 1.00
R8909:Lingo2 UTSW 4 35,708,349 (GRCm39) missense probably damaging 0.99
R9418:Lingo2 UTSW 4 35,709,035 (GRCm39) missense probably benign 0.38
R9612:Lingo2 UTSW 4 35,708,450 (GRCm39) missense probably damaging 0.99
R9633:Lingo2 UTSW 4 35,709,885 (GRCm39) missense
R9764:Lingo2 UTSW 4 35,709,750 (GRCm39) missense possibly damaging 0.55
R9775:Lingo2 UTSW 4 35,708,781 (GRCm39) missense probably benign 0.16
Z1177:Lingo2 UTSW 4 35,709,656 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TAAAGGGACCAACTTAAGGCGATTG -3'
(R):5'- CCCGTAACCAAGGTGTAGAC -3'

Sequencing Primer
(F):5'- ATTGCCTTTTAGGCGGAG -3'
(R):5'- CAAAGAAGTGGAGTCATGCTTC -3'
Posted On 2015-06-10