Incidental Mutation 'R4207:Slc24a2'
ID 318957
Institutional Source Beutler Lab
Gene Symbol Slc24a2
Ensembl Gene ENSMUSG00000037996
Gene Name solute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms 6330417K15Rik
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 86901361-87148714 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87145442 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 204 (V204A)
Ref Sequence ENSEMBL: ENSMUSP00000102776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044990] [ENSMUST00000107155] [ENSMUST00000107157] [ENSMUST00000107158]
AlphaFold Q14BI1
Predicted Effect probably damaging
Transcript: ENSMUST00000044990
AA Change: V204A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043937
Gene: ENSMUSG00000037996
AA Change: V204A

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.7e-34 PFAM
low complexity region 445 457 N/A INTRINSIC
transmembrane domain 472 489 N/A INTRINSIC
Pfam:Na_Ca_ex 509 648 8.9e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107155
AA Change: V204A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102773
Gene: ENSMUSG00000037996
AA Change: V204A

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.6e-34 PFAM
low complexity region 428 440 N/A INTRINSIC
transmembrane domain 455 472 N/A INTRINSIC
Pfam:Na_Ca_ex 492 631 8.5e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107157
AA Change: V204A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102775
Gene: ENSMUSG00000037996
AA Change: V204A

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 7.2e-32 PFAM
transmembrane domain 476 493 N/A INTRINSIC
Pfam:Na_Ca_ex 503 654 4.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107158
AA Change: V204A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102776
Gene: ENSMUSG00000037996
AA Change: V204A

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 8e-32 PFAM
transmembrane domain 521 538 N/A INTRINSIC
Pfam:Na_Ca_ex 548 699 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155361
Meta Mutation Damage Score 0.2800 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in loss of long term potentiation and an increase in long term depression and deficits in motor learning and spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Adgrg4 G A X: 55,964,109 (GRCm39) V1893I possibly damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Fcgr3 T A 1: 170,881,644 (GRCm39) K160N probably benign Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Mthfsd A G 8: 121,832,365 (GRCm39) V133A probably damaging Het
Nav2 T A 7: 49,246,979 (GRCm39) I2168N probably damaging Het
Nav2 T A 7: 49,222,046 (GRCm39) probably null Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Pld5 T G 1: 175,821,441 (GRCm39) T242P probably damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rhag A T 17: 41,142,544 (GRCm39) I250F probably damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Scaf4 C T 16: 90,057,103 (GRCm39) V83I unknown Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r85 A C 10: 130,254,574 (GRCm39) C703W probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Zfp81 C T 17: 33,553,890 (GRCm39) C308Y probably damaging Het
Other mutations in Slc24a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc24a2 APN 4 87,146,033 (GRCm39) missense probably benign 0.01
IGL02080:Slc24a2 APN 4 87,145,383 (GRCm39) missense probably damaging 1.00
IGL03121:Slc24a2 APN 4 87,145,143 (GRCm39) missense probably benign 0.00
G1patch:Slc24a2 UTSW 4 87,145,119 (GRCm39) critical splice donor site probably null
PIT4403001:Slc24a2 UTSW 4 86,950,523 (GRCm39) missense probably benign 0.45
R0024:Slc24a2 UTSW 4 86,946,477 (GRCm39) unclassified probably benign
R0024:Slc24a2 UTSW 4 86,946,477 (GRCm39) unclassified probably benign
R0372:Slc24a2 UTSW 4 87,145,529 (GRCm39) missense probably damaging 1.00
R1034:Slc24a2 UTSW 4 86,950,512 (GRCm39) missense probably damaging 0.99
R1577:Slc24a2 UTSW 4 86,909,648 (GRCm39) missense probably damaging 1.00
R1776:Slc24a2 UTSW 4 87,094,526 (GRCm39) missense probably benign 0.01
R1955:Slc24a2 UTSW 4 86,991,481 (GRCm39) missense probably damaging 1.00
R2043:Slc24a2 UTSW 4 86,914,882 (GRCm39) missense probably damaging 1.00
R2091:Slc24a2 UTSW 4 86,929,883 (GRCm39) missense probably damaging 1.00
R2114:Slc24a2 UTSW 4 86,909,592 (GRCm39) missense probably benign 0.07
R2921:Slc24a2 UTSW 4 86,909,591 (GRCm39) missense possibly damaging 0.46
R2922:Slc24a2 UTSW 4 86,909,591 (GRCm39) missense possibly damaging 0.46
R2924:Slc24a2 UTSW 4 86,929,961 (GRCm39) missense probably benign 0.34
R3806:Slc24a2 UTSW 4 87,146,021 (GRCm39) missense possibly damaging 0.92
R3933:Slc24a2 UTSW 4 87,094,422 (GRCm39) missense probably benign
R4052:Slc24a2 UTSW 4 87,145,442 (GRCm39) missense probably damaging 1.00
R4466:Slc24a2 UTSW 4 87,146,099 (GRCm39) utr 5 prime probably benign
R4531:Slc24a2 UTSW 4 86,909,715 (GRCm39) missense possibly damaging 0.91
R4561:Slc24a2 UTSW 4 87,145,634 (GRCm39) missense probably damaging 1.00
R4808:Slc24a2 UTSW 4 86,950,475 (GRCm39) missense probably benign 0.01
R4884:Slc24a2 UTSW 4 86,909,745 (GRCm39) missense probably damaging 0.98
R4893:Slc24a2 UTSW 4 87,145,145 (GRCm39) missense probably damaging 0.98
R4936:Slc24a2 UTSW 4 87,145,584 (GRCm39) missense probably damaging 1.00
R5035:Slc24a2 UTSW 4 86,929,943 (GRCm39) missense possibly damaging 0.48
R5171:Slc24a2 UTSW 4 86,914,871 (GRCm39) missense probably benign 0.40
R5369:Slc24a2 UTSW 4 86,909,625 (GRCm39) missense probably damaging 0.99
R5924:Slc24a2 UTSW 4 86,929,825 (GRCm39) splice site probably null
R6046:Slc24a2 UTSW 4 86,914,882 (GRCm39) missense probably damaging 1.00
R6725:Slc24a2 UTSW 4 87,145,119 (GRCm39) critical splice donor site probably null
R6756:Slc24a2 UTSW 4 87,094,529 (GRCm39) missense probably benign
R7087:Slc24a2 UTSW 4 86,909,456 (GRCm39) splice site probably null
R7804:Slc24a2 UTSW 4 86,909,774 (GRCm39) missense probably damaging 1.00
R8003:Slc24a2 UTSW 4 87,094,552 (GRCm39) missense probably benign 0.04
R8058:Slc24a2 UTSW 4 86,909,750 (GRCm39) missense probably damaging 1.00
R8428:Slc24a2 UTSW 4 87,145,337 (GRCm39) missense probably damaging 1.00
R8529:Slc24a2 UTSW 4 86,946,517 (GRCm39) missense possibly damaging 0.51
R9656:Slc24a2 UTSW 4 86,968,144 (GRCm39) missense probably damaging 1.00
X0003:Slc24a2 UTSW 4 86,909,684 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGAGTAAGCTTTCCCACC -3'
(R):5'- CTGCATGTCATTGGGATGATC -3'

Sequencing Primer
(F):5'- GGAGTAAGCTTTCCCACCACATG -3'
(R):5'- CTATATGTTCATAGCATTAGCCATCG -3'
Posted On 2015-06-10