Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Zfp644'

318959

Institutional Source

Beutler Lab

Gene Symbol

Zfp644

Ensembl Gene

ENSMUSG00000049606

Gene Name

zinc finger protein 644

Synonyms

D5Ertd689e, 1110068L01Rik, Zep-2, BM-005

MMRRC Submission

041036-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.277) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106616739-106697287 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106618276 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 93 (E93G)

Ref Sequence

ENSEMBL: ENSMUSP00000108315 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045466] [ENSMUST00000112695] [ENSMUST00000112696] [ENSMUST00000112698]

AlphaFold

E9QA22

Predicted Effect

probably damaging
Transcript: ENSMUST00000045466
AA Change: E1280G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038047
Gene: ENSMUSG00000049606
AA Change: E1280G

Domain	Start	End	E-Value	Type
ZnF_C2H2	411	433	1.89e-1	SMART
ZnF_C2H2	449	471	6.52e-5	SMART
ZnF_C2H2	497	519	1.99e0	SMART
ZnF_C2H2	526	549	6.4e0	SMART
ZnF_C2H2	587	610	3.72e0	SMART
low complexity region	668	676	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
ZnF_C2H2	928	950	1.07e0	SMART
ZnF_C2H2	1003	1025	1.43e-1	SMART
low complexity region	1199	1212	N/A	INTRINSIC
ZnF_C2H2	1226	1252	5.4e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112694

SMART Domains

Protein: ENSMUSP00000108314
Gene: ENSMUSG00000049606

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
Blast:ZnF_C2H2	34	60	1e-14	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000112695
AA Change: E93G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108315
Gene: ENSMUSG00000049606
AA Change: E93G

Domain	Start	End	E-Value	Type
low complexity region	12	25	N/A	INTRINSIC
Blast:ZnF_C2H2	39	65	2e-14	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000112696
AA Change: E1311G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108316
Gene: ENSMUSG00000049606
AA Change: E1311G

Domain	Start	End	E-Value	Type
ZnF_C2H2	411	433	1.89e-1	SMART
ZnF_C2H2	449	471	6.52e-5	SMART
ZnF_C2H2	497	519	1.99e0	SMART
ZnF_C2H2	526	549	6.4e0	SMART
ZnF_C2H2	587	610	3.72e0	SMART
low complexity region	668	676	N/A	INTRINSIC
low complexity region	767	783	N/A	INTRINSIC
low complexity region	802	819	N/A	INTRINSIC
ZnF_C2H2	959	981	1.07e0	SMART
ZnF_C2H2	1034	1056	1.43e-1	SMART
low complexity region	1230	1243	N/A	INTRINSIC
ZnF_C2H2	1257	1283	5.4e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112698
AA Change: E1280G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108318
Gene: ENSMUSG00000049606
AA Change: E1280G

Domain	Start	End	E-Value	Type
ZnF_C2H2	411	433	1.89e-1	SMART
ZnF_C2H2	449	471	6.52e-5	SMART
ZnF_C2H2	497	519	1.99e0	SMART
ZnF_C2H2	526	549	6.4e0	SMART
ZnF_C2H2	587	610	3.72e0	SMART
low complexity region	668	676	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
ZnF_C2H2	928	950	1.07e0	SMART
ZnF_C2H2	1003	1025	1.43e-1	SMART
low complexity region	1199	1212	N/A	INTRINSIC
ZnF_C2H2	1226	1252	5.4e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149128

Meta Mutation Damage Score

0.0755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that may play a role in eye development. Defects in this gene have been associated with high myopia. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Ap1b1	A	G	11: 5,031,637	D515G	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Cand1	T	C	10: 119,211,845	D580G	probably damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ctnnd2	G	T	15: 30,972,827	V1033F	probably damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nav2	T	A	7: 49,572,298		probably null	Het
Nav2	T	A	7: 49,597,231	I2168N	probably damaging	Het
Nlrp10	T	A	7: 108,924,341	D644V	possibly damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Slc5a8	G	T	10: 88,911,413	L409F	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp292	T	C	4: 34,806,079	I2322V	probably benign	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Zfp644

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Zfp644	APN	5	106638637	critical splice acceptor site	probably null
IGL01654:Zfp644	APN	5	106635930	missense	probably damaging	1.00
IGL01967:Zfp644	APN	5	106638243	missense	probably damaging	1.00
IGL02132:Zfp644	APN	5	106635894	missense	probably benign	0.22
IGL02164:Zfp644	APN	5	106638099	missense	probably benign	0.01
IGL02303:Zfp644	APN	5	106637314	missense	probably damaging	1.00
IGL03091:Zfp644	APN	5	106636858	missense	probably damaging	1.00
IGL03102:Zfp644	APN	5	106637268	missense	probably damaging	0.99
IGL03298:Zfp644	APN	5	106635101	missense	possibly damaging	0.93
PIT4466001:Zfp644	UTSW	5	106636477	missense	probably damaging	0.99
R0012:Zfp644	UTSW	5	106635043	missense	probably benign	0.11
R0012:Zfp644	UTSW	5	106635043	missense	probably benign	0.11
R0038:Zfp644	UTSW	5	106635043	missense	probably benign	0.11
R0038:Zfp644	UTSW	5	106635043	missense	probably benign	0.11
R0058:Zfp644	UTSW	5	106637003	missense	possibly damaging	0.69
R0058:Zfp644	UTSW	5	106637003	missense	possibly damaging	0.69
R0178:Zfp644	UTSW	5	106636905	missense	probably damaging	1.00
R0497:Zfp644	UTSW	5	106638333	missense	probably damaging	0.99
R1302:Zfp644	UTSW	5	106634899	missense	probably damaging	1.00
R1337:Zfp644	UTSW	5	106637554	missense	probably damaging	0.99
R1400:Zfp644	UTSW	5	106637470	splice site	probably null
R1597:Zfp644	UTSW	5	106638333	missense	probably damaging	0.99
R1911:Zfp644	UTSW	5	106635271	missense	possibly damaging	0.95
R2021:Zfp644	UTSW	5	106635682	missense	possibly damaging	0.84
R2196:Zfp644	UTSW	5	106638603	start codon destroyed	probably null	0.02
R2256:Zfp644	UTSW	5	106635845	missense	probably damaging	1.00
R2311:Zfp644	UTSW	5	106634956	missense	probably benign	0.21
R2420:Zfp644	UTSW	5	106637244	missense	possibly damaging	0.95
R2421:Zfp644	UTSW	5	106637244	missense	possibly damaging	0.95
R2422:Zfp644	UTSW	5	106637244	missense	possibly damaging	0.95
R3752:Zfp644	UTSW	5	106636383	missense	probably benign
R4285:Zfp644	UTSW	5	106635118	missense	probably damaging	1.00
R4874:Zfp644	UTSW	5	106635413	missense	probably damaging	1.00
R4961:Zfp644	UTSW	5	106618215	utr 3 prime	probably benign
R4984:Zfp644	UTSW	5	106636917	missense	possibly damaging	0.96
R5007:Zfp644	UTSW	5	106636001	missense	probably benign
R5358:Zfp644	UTSW	5	106635675	missense	probably damaging	1.00
R5382:Zfp644	UTSW	5	106634869	missense	possibly damaging	0.88
R5416:Zfp644	UTSW	5	106618428	splice site	silent
R5641:Zfp644	UTSW	5	106619595	missense	probably damaging	1.00
R5656:Zfp644	UTSW	5	106637982	missense	probably benign	0.12
R5732:Zfp644	UTSW	5	106637123	missense	probably damaging	1.00
R6039:Zfp644	UTSW	5	106635425	missense	possibly damaging	0.93
R6039:Zfp644	UTSW	5	106635425	missense	possibly damaging	0.93
R6306:Zfp644	UTSW	5	106638124	missense	probably damaging	0.99
R6317:Zfp644	UTSW	5	106635845	missense	probably damaging	1.00
R6354:Zfp644	UTSW	5	106636753	missense	probably benign	0.23
R6886:Zfp644	UTSW	5	106637911	missense	possibly damaging	0.53
R7223:Zfp644	UTSW	5	106637582	nonsense	probably null
R7326:Zfp644	UTSW	5	106638277	missense	probably benign	0.12
R7450:Zfp644	UTSW	5	106638526	missense	probably benign	0.00
R8095:Zfp644	UTSW	5	106618414	missense	possibly damaging	0.93
R8710:Zfp644	UTSW	5	106635131	missense	probably damaging	0.99
R8822:Zfp644	UTSW	5	106635221	missense	possibly damaging	0.93
R8936:Zfp644	UTSW	5	106635637	missense	probably damaging	1.00
R8975:Zfp644	UTSW	5	106637601	missense	probably benign
R9056:Zfp644	UTSW	5	106636078	nonsense	probably null
R9192:Zfp644	UTSW	5	106637963	missense	probably benign
R9250:Zfp644	UTSW	5	106636833	missense	probably damaging	0.99
R9287:Zfp644	UTSW	5	106637908	missense	possibly damaging	0.94
R9313:Zfp644	UTSW	5	106636458	missense	probably benign	0.25
R9600:Zfp644	UTSW	5	106636043	missense	probably benign
R9766:Zfp644	UTSW	5	106636825	missense	probably damaging	1.00
R9789:Zfp644	UTSW	5	106638265	missense	possibly damaging	0.91
X0011:Zfp644	UTSW	5	106618427	missense	probably damaging	1.00
Z1176:Zfp644	UTSW	5	106635744	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCTCCGATGCCACTCTAATT -3'
(R):5'- AGATTTATTTCTTACATTGTGGGCT -3'

Sequencing Primer
(F):5'- CCGATGCCACTCTAATTTACGG -3'
(R):5'- GACCATTGTCTGTTCAGG -3'

Posted On

2015-06-10