Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Nav2'

318966

Institutional Source

Beutler Lab

Gene Symbol

Nav2

Ensembl Gene

ENSMUSG00000052512

Gene Name

neuron navigator 2

Synonyms

Rainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2

MMRRC Submission

041036-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.631) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48908716-49610090 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 49572298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000139045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184945]

AlphaFold

E9Q842

Predicted Effect

probably null
Transcript: ENSMUST00000064395

SMART Domains

Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000183659

SMART Domains

Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
CH	23	126	6.19e-16	SMART
low complexity region	141	149	N/A	INTRINSIC
low complexity region	236	249	N/A	INTRINSIC
low complexity region	276	287	N/A	INTRINSIC
low complexity region	351	363	N/A	INTRINSIC
coiled coil region	425	455	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC
low complexity region	552	564	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
low complexity region	859	883	N/A	INTRINSIC
low complexity region	886	906	N/A	INTRINSIC
low complexity region	929	943	N/A	INTRINSIC
low complexity region	1001	1013	N/A	INTRINSIC
low complexity region	1282	1299	N/A	INTRINSIC
low complexity region	1307	1324	N/A	INTRINSIC
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1465	1479	N/A	INTRINSIC
low complexity region	1553	1567	N/A	INTRINSIC
coiled coil region	1569	1656	N/A	INTRINSIC
low complexity region	1728	1739	N/A	INTRINSIC
coiled coil region	1780	1848	N/A	INTRINSIC
AAA	2032	2186	1.69e-5	SMART
low complexity region	2343	2369	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184102

Predicted Effect

probably null
Transcript: ENSMUST00000184945

SMART Domains

Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Ap1b1	A	G	11: 5,031,637	D515G	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Cand1	T	C	10: 119,211,845	D580G	probably damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ctnnd2	G	T	15: 30,972,827	V1033F	probably damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nlrp10	T	A	7: 108,924,341	D644V	possibly damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Slc5a8	G	T	10: 88,911,413	L409F	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp292	T	C	4: 34,806,079	I2322V	probably benign	Het
Zfp644	T	C	5: 106,618,276	E93G	probably damaging	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Nav2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Nav2	APN	7	49571194	missense	probably damaging	1.00
IGL01150:Nav2	APN	7	49452521	missense	probably benign	0.17
IGL01649:Nav2	APN	7	49575729	missense	probably damaging	1.00
IGL01662:Nav2	APN	7	49571209	missense	probably damaging	1.00
IGL02297:Nav2	APN	7	49594229	missense	probably damaging	0.98
IGL02313:Nav2	APN	7	49558773	missense	probably damaging	0.99
IGL02441:Nav2	APN	7	49452512	missense	probably damaging	1.00
IGL02472:Nav2	APN	7	49546041	missense	probably damaging	1.00
IGL02477:Nav2	APN	7	49582875	missense	probably damaging	0.99
IGL02725:Nav2	APN	7	49565095	missense	probably damaging	1.00
IGL02944:Nav2	APN	7	49420256	missense	probably damaging	0.99
IGL02953:Nav2	APN	7	49548423	missense	probably damaging	1.00
IGL03105:Nav2	APN	7	49464879	missense	probably damaging	1.00
IGL03234:Nav2	APN	7	49462008	missense	possibly damaging	0.94
IGL03274:Nav2	APN	7	49362099	missense	probably damaging	1.00
IGL03294:Nav2	APN	7	49491457	nonsense	probably null
R0006:Nav2	UTSW	7	49453230	missense	possibly damaging	0.50
R0070:Nav2	UTSW	7	49570714	missense	probably damaging	1.00
R0113:Nav2	UTSW	7	49535953	missense	probably damaging	1.00
R0306:Nav2	UTSW	7	49545903	missense	probably benign	0.01
R0346:Nav2	UTSW	7	49604585	missense	probably benign	0.11
R0539:Nav2	UTSW	7	49461938	missense	probably damaging	1.00
R0669:Nav2	UTSW	7	49408683	missense	probably damaging	1.00
R0785:Nav2	UTSW	7	49420333	missense	probably benign	0.06
R0970:Nav2	UTSW	7	49584153	missense	probably damaging	1.00
R1162:Nav2	UTSW	7	49536040	splice site	probably benign
R1274:Nav2	UTSW	7	49604430	nonsense	probably null
R1463:Nav2	UTSW	7	49535962	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1536:Nav2	UTSW	7	49545934	missense	probably damaging	1.00
R1612:Nav2	UTSW	7	49571211	missense	probably damaging	1.00
R1638:Nav2	UTSW	7	49452465	missense	probably benign
R1731:Nav2	UTSW	7	49548174	missense	probably damaging	1.00
R1734:Nav2	UTSW	7	49575720	missense	probably damaging	1.00
R1865:Nav2	UTSW	7	49548195	missense	possibly damaging	0.95
R1945:Nav2	UTSW	7	49464872	missense	probably damaging	1.00
R1997:Nav2	UTSW	7	49548471	missense	probably benign	0.16
R2061:Nav2	UTSW	7	49598897	splice site	probably benign
R2117:Nav2	UTSW	7	49464580	missense	probably benign	0.00
R2174:Nav2	UTSW	7	49452663	missense	probably damaging	0.99
R2182:Nav2	UTSW	7	49597254	missense	probably benign	0.38
R2251:Nav2	UTSW	7	49453277	missense	probably damaging	1.00
R2283:Nav2	UTSW	7	49491404	missense	probably damaging	1.00
R2343:Nav2	UTSW	7	49598817	missense	possibly damaging	0.82
R2472:Nav2	UTSW	7	49408884	missense	probably benign
R2568:Nav2	UTSW	7	49597564	missense	probably damaging	1.00
R2656:Nav2	UTSW	7	49545942	missense	probably damaging	1.00
R2964:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R2966:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R3817:Nav2	UTSW	7	49464562	missense	probably benign	0.00
R3834:Nav2	UTSW	7	49545858	missense	possibly damaging	0.91
R4207:Nav2	UTSW	7	49597231	missense	probably damaging	1.00
R4411:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4413:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4440:Nav2	UTSW	7	49552037	missense	possibly damaging	0.86
R4440:Nav2	UTSW	7	49575263	splice site	probably benign
R4454:Nav2	UTSW	7	49548544	splice site	probably null
R4729:Nav2	UTSW	7	49452819	missense	probably benign	0.17
R4801:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4802:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4824:Nav2	UTSW	7	49409001	intron	probably benign
R4887:Nav2	UTSW	7	49548434	nonsense	probably null
R4908:Nav2	UTSW	7	49604510	missense	probably damaging	1.00
R4952:Nav2	UTSW	7	49304540	intron	probably benign
R4965:Nav2	UTSW	7	49552877	nonsense	probably null
R5169:Nav2	UTSW	7	49548483	nonsense	probably null
R5224:Nav2	UTSW	7	49551725	missense	probably benign	0.00
R5249:Nav2	UTSW	7	49535913	missense	probably damaging	1.00
R5285:Nav2	UTSW	7	49548234	missense	probably damaging	1.00
R5314:Nav2	UTSW	7	49408692	small deletion	probably benign
R5320:Nav2	UTSW	7	49491373	missense	probably benign	0.00
R5377:Nav2	UTSW	7	49589160	missense	probably benign	0.02
R5471:Nav2	UTSW	7	49548169	missense	probably damaging	1.00
R5754:Nav2	UTSW	7	49557046	missense	probably damaging	1.00
R5832:Nav2	UTSW	7	49548069	splice site	probably null
R5884:Nav2	UTSW	7	49597169	nonsense	probably null
R5921:Nav2	UTSW	7	49304576	intron	probably benign
R6180:Nav2	UTSW	7	49458167	missense	probably benign	0.39
R6208:Nav2	UTSW	7	49564103	missense	probably damaging	0.99
R6373:Nav2	UTSW	7	49453175	missense	probably damaging	1.00
R6450:Nav2	UTSW	7	49594366	missense	probably damaging	1.00
R6522:Nav2	UTSW	7	49597533	missense	probably damaging	1.00
R6626:Nav2	UTSW	7	49594352	missense	probably damaging	1.00
R6695:Nav2	UTSW	7	49464904	missense	probably benign	0.04
R6705:Nav2	UTSW	7	49551916	missense	probably damaging	1.00
R6842:Nav2	UTSW	7	49458169	missense	possibly damaging	0.91
R6847:Nav2	UTSW	7	49491456	missense	probably benign	0.14
R7287:Nav2	UTSW	7	49420328	missense	probably benign	0.01
R7312:Nav2	UTSW	7	49461924	missense	possibly damaging	0.55
R7315:Nav2	UTSW	7	49548289	missense	possibly damaging	0.61
R7337:Nav2	UTSW	7	49551773	missense	possibly damaging	0.56
R7366:Nav2	UTSW	7	49554203	splice site	probably null
R7451:Nav2	UTSW	7	49552829	splice site	probably null
R7545:Nav2	UTSW	7	49582857	missense	probably damaging	1.00
R7706:Nav2	UTSW	7	49594319	missense	probably benign	0.35
R7730:Nav2	UTSW	7	49572397	missense	probably damaging	1.00
R7812:Nav2	UTSW	7	49597173	missense	probably benign	0.13
R8097:Nav2	UTSW	7	49587777	missense	probably damaging	1.00
R8110:Nav2	UTSW	7	49551950	nonsense	probably null
R8119:Nav2	UTSW	7	49453484	missense	probably damaging	0.99
R8298:Nav2	UTSW	7	49554261	critical splice donor site	probably null
R8306:Nav2	UTSW	7	49546017	missense	probably benign	0.33
R8331:Nav2	UTSW	7	49452623	missense	probably benign
R8402:Nav2	UTSW	7	49453437	missense	probably benign	0.43
R8421:Nav2	UTSW	7	49452521	missense	probably benign
R8478:Nav2	UTSW	7	49461985	missense	probably damaging	0.99
R8724:Nav2	UTSW	7	49491436	missense	possibly damaging	0.82
R8753:Nav2	UTSW	7	49452572	missense	probably benign
R8835:Nav2	UTSW	7	49598803	missense	possibly damaging	0.83
R8933:Nav2	UTSW	7	49461957	missense	probably damaging	1.00
R8957:Nav2	UTSW	7	49571216	missense	probably damaging	1.00
R9069:Nav2	UTSW	7	49558813	missense	probably damaging	0.99
R9095:Nav2	UTSW	7	49604545	missense	probably damaging	1.00
R9223:Nav2	UTSW	7	49552851	missense	probably damaging	1.00
R9261:Nav2	UTSW	7	49597156	missense	probably damaging	1.00
X0023:Nav2	UTSW	7	49547899	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49452761	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49594223	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GATTTGGCCATCCAGAGTGG -3'
(R):5'- GAGTCTAAGGGTGCACACTCAC -3'

Sequencing Primer
(F):5'- CAAGATGGCATGGAGAGCCTG -3'
(R):5'- GTGCACACTCACCCAGTTTTTC -3'

Posted On

2015-06-10