Incidental Mutation 'R4207:Nav2'
ID 318967
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Name neuron navigator 2
Synonyms Rainb1, Unc53H2, 5330421F07Rik, POMFIL2, HELAD1, RAINB2
MMRRC Submission 041036-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.550) question?
Stock # R4207 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 48608796-49259838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49246979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 2168 (I2168N)
Ref Sequence ENSEMBL: ENSMUSP00000067448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184945]
AlphaFold E9Q842
Predicted Effect probably damaging
Transcript: ENSMUST00000064395
AA Change: I2168N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: I2168N

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183659
AA Change: I2107N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: I2107N

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184945
AA Change: I2168N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: I2168N

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Meta Mutation Damage Score 0.7739 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G A 11: 109,872,551 (GRCm39) Q17* probably null Het
Acap2 T A 16: 30,938,245 (GRCm39) N293I probably damaging Het
Adgrg4 G A X: 55,964,109 (GRCm39) V1893I possibly damaging Het
Aff1 T C 5: 103,966,854 (GRCm39) probably null Het
Ap1b1 A G 11: 4,981,637 (GRCm39) D515G probably damaging Het
Brk1 T C 6: 113,592,805 (GRCm39) Y63H possibly damaging Het
Cand1 T C 10: 119,047,750 (GRCm39) D580G probably damaging Het
Casp4 A G 9: 5,328,451 (GRCm39) D311G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Ctnnd2 G T 15: 30,972,973 (GRCm39) V1033F probably damaging Het
Dhx29 G T 13: 113,064,483 (GRCm39) A53S probably benign Het
Dis3 T G 14: 99,332,752 (GRCm39) I227L probably benign Het
Efhc2 T C X: 17,096,789 (GRCm39) N186S possibly damaging Het
Efl1 T C 7: 82,400,024 (GRCm39) V592A probably damaging Het
Elovl7 A T 13: 108,419,040 (GRCm39) Q224L possibly damaging Het
Fcgr3 T A 1: 170,881,644 (GRCm39) K160N probably benign Het
Flg A G 3: 93,187,169 (GRCm39) Y207C probably benign Het
Fmn2 A G 1: 174,409,521 (GRCm39) T585A unknown Het
Gm7135 T C 1: 97,397,620 (GRCm39) noncoding transcript Het
Gm8104 G T 14: 42,959,091 (GRCm39) D94Y probably damaging Het
Hjurp G C 1: 88,204,937 (GRCm39) probably benign Het
Ino80b G C 6: 83,099,314 (GRCm39) P178R probably damaging Het
Kbtbd4 T C 2: 90,740,099 (GRCm39) F495L probably damaging Het
Lingo2 T C 4: 35,709,810 (GRCm39) I57V probably benign Het
Me2 T C 18: 73,924,156 (GRCm39) K352R probably benign Het
Mthfsd A G 8: 121,832,365 (GRCm39) V133A probably damaging Het
Nlrp10 T A 7: 108,523,548 (GRCm39) D644V possibly damaging Het
Oplah C T 15: 76,186,910 (GRCm39) R635H probably damaging Het
Or10n1 A G 9: 39,525,253 (GRCm39) Y130C possibly damaging Het
Or2c1 T C 16: 3,657,434 (GRCm39) L199P probably damaging Het
Or5b117 T C 19: 13,431,835 (GRCm39) I15M probably benign Het
Peli1 A G 11: 21,097,115 (GRCm39) probably null Het
Pfkfb1 A T X: 149,405,184 (GRCm39) D208V possibly damaging Het
Pld5 T G 1: 175,821,441 (GRCm39) T242P probably damaging Het
Rbm5 A G 9: 107,627,682 (GRCm39) S420P probably benign Het
Rhag A T 17: 41,142,544 (GRCm39) I250F probably damaging Het
Rnase4 A G 14: 51,342,462 (GRCm39) K62R probably benign Het
Scaf4 C T 16: 90,057,103 (GRCm39) V83I unknown Het
Slc24a2 A G 4: 87,145,442 (GRCm39) V204A probably damaging Het
Slc5a8 G T 10: 88,747,275 (GRCm39) L409F probably damaging Het
Spns3 A T 11: 72,429,187 (GRCm39) V199E probably damaging Het
Sspo A G 6: 48,455,227 (GRCm39) T3030A probably benign Het
Sstr2 A C 11: 113,515,482 (GRCm39) T134P probably damaging Het
Stk39 G T 2: 68,051,264 (GRCm39) T527K probably benign Het
Sult2a1 T A 7: 13,535,472 (GRCm39) T194S probably benign Het
Tamm41 AGGG AGG 6: 114,989,320 (GRCm39) probably benign Het
Trav7-3 A G 14: 53,681,203 (GRCm39) T82A probably benign Het
Umodl1 G A 17: 31,178,341 (GRCm39) V106I probably damaging Het
Vmn2r85 A C 10: 130,254,574 (GRCm39) C703W probably damaging Het
Vmn2r92 G A 17: 18,404,523 (GRCm39) V556M possibly damaging Het
Zfp292 T C 4: 34,806,079 (GRCm39) I2322V probably benign Het
Zfp644 T C 5: 106,766,142 (GRCm39) E93G probably damaging Het
Zfp81 C T 17: 33,553,890 (GRCm39) C308Y probably damaging Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49,220,942 (GRCm39) missense probably damaging 1.00
IGL01150:Nav2 APN 7 49,102,269 (GRCm39) missense probably benign 0.17
IGL01649:Nav2 APN 7 49,225,477 (GRCm39) missense probably damaging 1.00
IGL01662:Nav2 APN 7 49,220,957 (GRCm39) missense probably damaging 1.00
IGL02297:Nav2 APN 7 49,243,977 (GRCm39) missense probably damaging 0.98
IGL02313:Nav2 APN 7 49,208,521 (GRCm39) missense probably damaging 0.99
IGL02441:Nav2 APN 7 49,102,260 (GRCm39) missense probably damaging 1.00
IGL02472:Nav2 APN 7 49,195,789 (GRCm39) missense probably damaging 1.00
IGL02477:Nav2 APN 7 49,232,623 (GRCm39) missense probably damaging 0.99
IGL02725:Nav2 APN 7 49,214,843 (GRCm39) missense probably damaging 1.00
IGL02944:Nav2 APN 7 49,070,004 (GRCm39) missense probably damaging 0.99
IGL02953:Nav2 APN 7 49,198,171 (GRCm39) missense probably damaging 1.00
IGL03105:Nav2 APN 7 49,114,627 (GRCm39) missense probably damaging 1.00
IGL03234:Nav2 APN 7 49,111,756 (GRCm39) missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49,011,847 (GRCm39) missense probably damaging 1.00
IGL03294:Nav2 APN 7 49,141,205 (GRCm39) nonsense probably null
R0006:Nav2 UTSW 7 49,102,978 (GRCm39) missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49,220,462 (GRCm39) missense probably damaging 1.00
R0113:Nav2 UTSW 7 49,185,701 (GRCm39) missense probably damaging 1.00
R0306:Nav2 UTSW 7 49,195,651 (GRCm39) missense probably benign 0.01
R0346:Nav2 UTSW 7 49,254,333 (GRCm39) missense probably benign 0.11
R0539:Nav2 UTSW 7 49,111,686 (GRCm39) missense probably damaging 1.00
R0669:Nav2 UTSW 7 49,058,431 (GRCm39) missense probably damaging 1.00
R0785:Nav2 UTSW 7 49,070,081 (GRCm39) missense probably benign 0.06
R0970:Nav2 UTSW 7 49,233,901 (GRCm39) missense probably damaging 1.00
R1162:Nav2 UTSW 7 49,185,788 (GRCm39) splice site probably benign
R1274:Nav2 UTSW 7 49,254,178 (GRCm39) nonsense probably null
R1463:Nav2 UTSW 7 49,185,710 (GRCm39) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,011,952 (GRCm39) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,011,952 (GRCm39) missense probably damaging 1.00
R1536:Nav2 UTSW 7 49,195,682 (GRCm39) missense probably damaging 1.00
R1612:Nav2 UTSW 7 49,220,959 (GRCm39) missense probably damaging 1.00
R1638:Nav2 UTSW 7 49,102,213 (GRCm39) missense probably benign
R1731:Nav2 UTSW 7 49,197,922 (GRCm39) missense probably damaging 1.00
R1734:Nav2 UTSW 7 49,225,468 (GRCm39) missense probably damaging 1.00
R1865:Nav2 UTSW 7 49,197,943 (GRCm39) missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49,114,620 (GRCm39) missense probably damaging 1.00
R1997:Nav2 UTSW 7 49,198,219 (GRCm39) missense probably benign 0.16
R2061:Nav2 UTSW 7 49,248,645 (GRCm39) splice site probably benign
R2117:Nav2 UTSW 7 49,114,328 (GRCm39) missense probably benign 0.00
R2174:Nav2 UTSW 7 49,102,411 (GRCm39) missense probably damaging 0.99
R2182:Nav2 UTSW 7 49,247,002 (GRCm39) missense probably benign 0.38
R2251:Nav2 UTSW 7 49,103,025 (GRCm39) missense probably damaging 1.00
R2283:Nav2 UTSW 7 49,141,152 (GRCm39) missense probably damaging 1.00
R2343:Nav2 UTSW 7 49,248,565 (GRCm39) missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49,058,632 (GRCm39) missense probably benign
R2568:Nav2 UTSW 7 49,247,312 (GRCm39) missense probably damaging 1.00
R2656:Nav2 UTSW 7 49,195,690 (GRCm39) missense probably damaging 1.00
R2964:Nav2 UTSW 7 49,206,780 (GRCm39) missense probably damaging 1.00
R2966:Nav2 UTSW 7 49,206,780 (GRCm39) missense probably damaging 1.00
R3817:Nav2 UTSW 7 49,114,310 (GRCm39) missense probably benign 0.00
R3834:Nav2 UTSW 7 49,195,606 (GRCm39) missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49,222,046 (GRCm39) splice site probably null
R4411:Nav2 UTSW 7 49,047,857 (GRCm39) missense probably benign 0.37
R4413:Nav2 UTSW 7 49,047,857 (GRCm39) missense probably benign 0.37
R4440:Nav2 UTSW 7 49,225,011 (GRCm39) splice site probably benign
R4440:Nav2 UTSW 7 49,201,785 (GRCm39) missense possibly damaging 0.86
R4454:Nav2 UTSW 7 49,198,292 (GRCm39) splice site probably null
R4729:Nav2 UTSW 7 49,102,567 (GRCm39) missense probably benign 0.17
R4801:Nav2 UTSW 7 49,195,600 (GRCm39) missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49,195,600 (GRCm39) missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49,058,749 (GRCm39) intron probably benign
R4887:Nav2 UTSW 7 49,198,182 (GRCm39) nonsense probably null
R4908:Nav2 UTSW 7 49,254,258 (GRCm39) missense probably damaging 1.00
R4952:Nav2 UTSW 7 48,954,288 (GRCm39) intron probably benign
R4965:Nav2 UTSW 7 49,202,625 (GRCm39) nonsense probably null
R5169:Nav2 UTSW 7 49,198,231 (GRCm39) nonsense probably null
R5224:Nav2 UTSW 7 49,201,473 (GRCm39) missense probably benign 0.00
R5249:Nav2 UTSW 7 49,185,661 (GRCm39) missense probably damaging 1.00
R5285:Nav2 UTSW 7 49,197,982 (GRCm39) missense probably damaging 1.00
R5314:Nav2 UTSW 7 49,058,440 (GRCm39) small deletion probably benign
R5320:Nav2 UTSW 7 49,141,121 (GRCm39) missense probably benign 0.00
R5377:Nav2 UTSW 7 49,238,908 (GRCm39) missense probably benign 0.02
R5471:Nav2 UTSW 7 49,197,917 (GRCm39) missense probably damaging 1.00
R5754:Nav2 UTSW 7 49,206,794 (GRCm39) missense probably damaging 1.00
R5832:Nav2 UTSW 7 49,197,817 (GRCm39) splice site probably null
R5884:Nav2 UTSW 7 49,246,917 (GRCm39) nonsense probably null
R5921:Nav2 UTSW 7 48,954,324 (GRCm39) intron probably benign
R6180:Nav2 UTSW 7 49,107,915 (GRCm39) missense probably benign 0.39
R6208:Nav2 UTSW 7 49,213,851 (GRCm39) missense probably damaging 0.99
R6373:Nav2 UTSW 7 49,102,923 (GRCm39) missense probably damaging 1.00
R6450:Nav2 UTSW 7 49,244,114 (GRCm39) missense probably damaging 1.00
R6522:Nav2 UTSW 7 49,247,281 (GRCm39) missense probably damaging 1.00
R6626:Nav2 UTSW 7 49,244,100 (GRCm39) missense probably damaging 1.00
R6695:Nav2 UTSW 7 49,114,652 (GRCm39) missense probably benign 0.04
R6705:Nav2 UTSW 7 49,201,664 (GRCm39) missense probably damaging 1.00
R6842:Nav2 UTSW 7 49,107,917 (GRCm39) missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49,141,204 (GRCm39) missense probably benign 0.14
R7287:Nav2 UTSW 7 49,070,076 (GRCm39) missense probably benign 0.01
R7312:Nav2 UTSW 7 49,111,672 (GRCm39) missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49,198,037 (GRCm39) missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49,201,521 (GRCm39) missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49,203,951 (GRCm39) splice site probably null
R7451:Nav2 UTSW 7 49,202,577 (GRCm39) splice site probably null
R7545:Nav2 UTSW 7 49,232,605 (GRCm39) missense probably damaging 1.00
R7706:Nav2 UTSW 7 49,244,067 (GRCm39) missense probably benign 0.35
R7730:Nav2 UTSW 7 49,222,145 (GRCm39) missense probably damaging 1.00
R7812:Nav2 UTSW 7 49,246,921 (GRCm39) missense probably benign 0.13
R8097:Nav2 UTSW 7 49,237,525 (GRCm39) missense probably damaging 1.00
R8110:Nav2 UTSW 7 49,201,698 (GRCm39) nonsense probably null
R8119:Nav2 UTSW 7 49,103,232 (GRCm39) missense probably damaging 0.99
R8298:Nav2 UTSW 7 49,204,009 (GRCm39) critical splice donor site probably null
R8306:Nav2 UTSW 7 49,195,765 (GRCm39) missense probably benign 0.33
R8331:Nav2 UTSW 7 49,102,371 (GRCm39) missense probably benign
R8402:Nav2 UTSW 7 49,103,185 (GRCm39) missense probably benign 0.43
R8421:Nav2 UTSW 7 49,102,269 (GRCm39) missense probably benign
R8478:Nav2 UTSW 7 49,111,733 (GRCm39) missense probably damaging 0.99
R8724:Nav2 UTSW 7 49,141,184 (GRCm39) missense possibly damaging 0.82
R8753:Nav2 UTSW 7 49,102,320 (GRCm39) missense probably benign
R8835:Nav2 UTSW 7 49,248,551 (GRCm39) missense possibly damaging 0.83
R8933:Nav2 UTSW 7 49,111,705 (GRCm39) missense probably damaging 1.00
R8957:Nav2 UTSW 7 49,220,964 (GRCm39) missense probably damaging 1.00
R9069:Nav2 UTSW 7 49,208,561 (GRCm39) missense probably damaging 0.99
R9095:Nav2 UTSW 7 49,254,293 (GRCm39) missense probably damaging 1.00
R9223:Nav2 UTSW 7 49,202,599 (GRCm39) missense probably damaging 1.00
R9261:Nav2 UTSW 7 49,246,904 (GRCm39) missense probably damaging 1.00
X0023:Nav2 UTSW 7 49,197,647 (GRCm39) missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49,243,971 (GRCm39) missense probably benign 0.01
Z1177:Nav2 UTSW 7 49,102,509 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CACAGTGTGACTTCATAAGGGG -3'
(R):5'- CTTACAGGCAAGGGACTATGGTC -3'

Sequencing Primer
(F):5'- GGTACCTTCTTCCTGCCTTGG -3'
(R):5'- CTCCCCCTCTGGCTGTG -3'
Posted On 2015-06-10