Mutagenetix > Incidental Mutation

Incidental Mutation 'R4207:Nlrp10'

318970

Institutional Source

Beutler Lab

Gene Symbol

Nlrp10

Ensembl Gene

ENSMUSG00000049709

Gene Name

NLR family, pyrin domain containing 10

Synonyms

Nalp10, 6430548I20Rik, Pynod

MMRRC Submission

041036-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4207 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108921852-108930178 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108924341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 644 (D644V)

Ref Sequence

ENSEMBL: ENSMUSP00000050252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055745]

AlphaFold

Q8CCN1

PDB Structure

Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055745
AA Change: D644V

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: D644V

Domain	Start	End	E-Value	Type
PYRIN	9	88	4.13e-18	SMART
low complexity region	126	137	N/A	INTRINSIC
AAA	161	302	1.07e-2	SMART
low complexity region	576	597	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	A	11: 109,981,725	Q17*	probably null	Het
Acap2	T	A	16: 31,119,427	N293I	probably damaging	Het
Adgrg4	G	A	X: 56,918,749	V1893I	possibly damaging	Het
Aff1	T	C	5: 103,818,988		probably null	Het
Ap1b1	A	G	11: 5,031,637	D515G	probably damaging	Het
Brk1	T	C	6: 113,615,844	Y63H	possibly damaging	Het
Cand1	T	C	10: 119,211,845	D580G	probably damaging	Het
Casp4	A	G	9: 5,328,451	D311G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Ctnnd2	G	T	15: 30,972,827	V1033F	probably damaging	Het
Dhx29	G	T	13: 112,927,949	A53S	probably benign	Het
Dis3	T	G	14: 99,095,316	I227L	probably benign	Het
Efhc2	T	C	X: 17,230,550	N186S	possibly damaging	Het
Efl1	T	C	7: 82,750,816	V592A	probably damaging	Het
Elovl7	A	T	13: 108,282,506	Q224L	possibly damaging	Het
Fcgr3	T	A	1: 171,054,075	K160N	probably benign	Het
Flg	A	G	3: 93,279,862	Y207C	probably benign	Het
Fmn2	A	G	1: 174,581,955	T585A	unknown	Het
Gm7135	T	C	1: 97,469,895		noncoding transcript	Het
Gm8104	G	T	14: 43,101,634	D94Y	probably damaging	Het
Hjurp	G	C	1: 88,277,215		probably benign	Het
Ino80b	G	C	6: 83,122,333	P178R	probably damaging	Het
Kbtbd4	T	C	2: 90,909,755	F495L	probably damaging	Het
Lingo2	T	C	4: 35,709,810	I57V	probably benign	Het
Me2	T	C	18: 73,791,085	K352R	probably benign	Het
Mthfsd	A	G	8: 121,105,626	V133A	probably damaging	Het
Nav2	T	A	7: 49,572,298		probably null	Het
Nav2	T	A	7: 49,597,231	I2168N	probably damaging	Het
Olfr1472	T	C	19: 13,454,471	I15M	probably benign	Het
Olfr148	A	G	9: 39,613,957	Y130C	possibly damaging	Het
Olfr15	T	C	16: 3,839,570	L199P	probably damaging	Het
Oplah	C	T	15: 76,302,710	R635H	probably damaging	Het
Peli1	A	G	11: 21,147,115		probably null	Het
Pfkfb1	A	T	X: 150,622,188	D208V	possibly damaging	Het
Pld5	T	G	1: 175,993,875	T242P	probably damaging	Het
Rbm5	A	G	9: 107,750,483	S420P	probably benign	Het
Rhag	A	T	17: 40,831,653	I250F	probably damaging	Het
Rnase4	A	G	14: 51,105,005	K62R	probably benign	Het
Scaf4	C	T	16: 90,260,215	V83I	unknown	Het
Slc24a2	A	G	4: 87,227,205	V204A	probably damaging	Het
Slc5a8	G	T	10: 88,911,413	L409F	probably damaging	Het
Spns3	A	T	11: 72,538,361	V199E	probably damaging	Het
Sspo	A	G	6: 48,478,293	T3030A	probably benign	Het
Sstr2	A	C	11: 113,624,656	T134P	probably damaging	Het
Stk39	G	T	2: 68,220,920	T527K	probably benign	Het
Sult2a1	T	A	7: 13,801,547	T194S	probably benign	Het
Tamm41	AGGG	AGG	6: 115,012,359		probably benign	Het
Trav7-3	A	G	14: 53,443,746	T82A	probably benign	Het
Umodl1	G	A	17: 30,959,367	V106I	probably damaging	Het
Vmn2r85	A	C	10: 130,418,705	C703W	probably damaging	Het
Vmn2r92	G	A	17: 18,184,261	V556M	possibly damaging	Het
Zfp292	T	C	4: 34,806,079	I2322V	probably benign	Het
Zfp644	T	C	5: 106,618,276	E93G	probably damaging	Het
Zfp81	C	T	17: 33,334,916	C308Y	probably damaging	Het

Other mutations in Nlrp10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01374:Nlrp10	APN	7	108924581	missense	possibly damaging	0.86
IGL01482:Nlrp10	APN	7	108926952	missense	probably benign
IGL02043:Nlrp10	APN	7	108925502	missense	probably damaging	0.99
IGL03129:Nlrp10	APN	7	108924911	missense	probably damaging	1.00
IGL02835:Nlrp10	UTSW	7	108924662	missense	possibly damaging	0.61
R0106:Nlrp10	UTSW	7	108925322	missense	possibly damaging	0.94
R0106:Nlrp10	UTSW	7	108925322	missense	possibly damaging	0.94
R0540:Nlrp10	UTSW	7	108924285	missense	probably benign	0.26
R0607:Nlrp10	UTSW	7	108924285	missense	probably benign	0.26
R1166:Nlrp10	UTSW	7	108925010	missense	probably damaging	1.00
R1248:Nlrp10	UTSW	7	108925881	missense	probably benign	0.08
R1450:Nlrp10	UTSW	7	108925388	missense	probably damaging	0.98
R1459:Nlrp10	UTSW	7	108924348	missense	probably benign
R1567:Nlrp10	UTSW	7	108927050	missense	probably benign	0.02
R1635:Nlrp10	UTSW	7	108924530	missense	possibly damaging	0.93
R1845:Nlrp10	UTSW	7	108927041	missense	probably damaging	1.00
R1912:Nlrp10	UTSW	7	108925395	nonsense	probably null
R1952:Nlrp10	UTSW	7	108924563	missense	probably benign	0.20
R1953:Nlrp10	UTSW	7	108925118	missense	probably benign	0.00
R2079:Nlrp10	UTSW	7	108925628	missense	possibly damaging	0.66
R3615:Nlrp10	UTSW	7	108924476	missense	probably benign
R3616:Nlrp10	UTSW	7	108924476	missense	probably benign
R4786:Nlrp10	UTSW	7	108925238	missense	probably damaging	1.00
R5048:Nlrp10	UTSW	7	108924565	missense	probably benign	0.01
R5568:Nlrp10	UTSW	7	108924261	missense	probably benign	0.00
R5993:Nlrp10	UTSW	7	108927013	missense	probably benign	0.00
R6033:Nlrp10	UTSW	7	108924577	missense	probably benign	0.17
R6033:Nlrp10	UTSW	7	108924577	missense	probably benign	0.17
R6170:Nlrp10	UTSW	7	108924464	missense	probably benign	0.00
R6320:Nlrp10	UTSW	7	108925746	missense	possibly damaging	0.82
R6935:Nlrp10	UTSW	7	108926900	missense	probably damaging	0.99
R7024:Nlrp10	UTSW	7	108925198	missense	possibly damaging	0.73
R7081:Nlrp10	UTSW	7	108924648	missense	probably benign	0.02
R7397:Nlrp10	UTSW	7	108924692	missense	probably damaging	1.00
R7720:Nlrp10	UTSW	7	108924488	missense	probably benign	0.36
R7763:Nlrp10	UTSW	7	108925826	missense	probably damaging	0.99
R7776:Nlrp10	UTSW	7	108925449	missense	probably damaging	1.00
R7823:Nlrp10	UTSW	7	108924261	missense	probably benign	0.00
R7852:Nlrp10	UTSW	7	108925074	missense	probably damaging	1.00
R8272:Nlrp10	UTSW	7	108925896	missense	probably benign	0.00
R9181:Nlrp10	UTSW	7	108924901	missense	probably damaging	0.99
R9712:Nlrp10	UTSW	7	108925528	missense	probably damaging	1.00
Z1177:Nlrp10	UTSW	7	108925851	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAATATCTGTGGTAAGGGCTGG -3'
(R):5'- TCAGTGACAAGCAGCTTTAGTAG -3'

Sequencing Primer
(F):5'- ATTGCACATGCTAAGACTCCTGG -3'
(R):5'- TAGCGGGAAGGTACAAAGTCCATTC -3'

Posted On

2015-06-10